ID: 1040491321

View in Genome Browser
Species Human (GRCh38)
Location 8:47924976-47924998
Sequence GGGGTGCAGGCAGGGTGAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1057
Summary {0: 1, 1: 1, 2: 3, 3: 102, 4: 950}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491321_1040491330 7 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491321_1040491335 25 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491335 8:47925024-47925046 CGTGGGTGCCTCATCTGGCTTGG No data
1040491321_1040491334 20 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data
1040491321_1040491336 26 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491336 8:47925025-47925047 GTGGGTGCCTCATCTGGCTTGGG No data
1040491321_1040491331 8 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491321 Original CRISPR GGGGTGCAGGCAGGGTGAGA AGG (reversed) Intronic
900179751 1:1305941-1305963 GGGGGCCAGGCAGGGTGGGCGGG - Intronic
900395227 1:2450678-2450700 GGGGGGCAGGCGGGGAGAGGGGG - Intronic
900485873 1:2922369-2922391 GGGGTCCAGGCAGGGTGGCCAGG + Intergenic
900715455 1:4140977-4140999 AGGGTGCAGGCACCGTGCGATGG + Intergenic
900745914 1:4360699-4360721 GAGGGGCAGGCAGGGTGCAAGGG - Intergenic
900939219 1:5787022-5787044 AGGGAGCAGGCAGGTAGAGAAGG + Intergenic
901055177 1:6445944-6445966 GGGAGGCAGGCAGGGGGTGAGGG - Intronic
901150468 1:7097843-7097865 GGGGTGGAGGGAGGGAGAAATGG + Intronic
901638690 1:10682282-10682304 GGGGTGCCGGGACGGGGAGAAGG + Intronic
901796678 1:11683514-11683536 GGGGGGAAGGAAGGGTGGGAAGG + Intronic
901933006 1:12608926-12608948 AGGGAGCAGGCTGGGTGACAAGG - Intronic
902290179 1:15430231-15430253 GGGGAGAAGGGAAGGTGAGAAGG - Exonic
902380511 1:16050292-16050314 GGGGCACAGGCAGGCTGGGAGGG - Intronic
902401319 1:16159005-16159027 GGGGTGCAGGCAGGCCCTGATGG + Intergenic
902570906 1:17346557-17346579 GGGAACCAGGCAGGCTGAGAGGG - Intronic
902616499 1:17626288-17626310 GGGTTGCAGGAAGGGAGTGAAGG + Intronic
902628309 1:17689490-17689512 GGGAGGCAGGGAGGGAGAGAGGG - Intronic
902727222 1:18345124-18345146 GGAGTGCAGGCAGAGGGAGAGGG - Intronic
903314628 1:22492493-22492515 AGGCTGCTGGCAGAGTGAGAGGG + Intronic
903544082 1:24112697-24112719 GTGGTGCAGGCAGGAGGAGCTGG + Intergenic
903713938 1:25348956-25348978 TGGGCTCAGGCAGGGTGGGAAGG + Intronic
903758294 1:25679365-25679387 GGGGAACAGGCTTGGTGAGACGG + Intronic
903848165 1:26290696-26290718 GGGGTGCTGGCAGGGAGAGGTGG + Intronic
903868730 1:26417041-26417063 TGGGTGGGGGCAGGGTGGGACGG + Intronic
903959450 1:27047485-27047507 GGTGGGCAGGCAGGGTGTGCAGG + Intergenic
903996355 1:27307509-27307531 GGGAAGCAGGGAGGGAGAGAGGG - Exonic
904261742 1:29291493-29291515 GGGGTGCAGTGGGGGTGAGGGGG + Intronic
904313059 1:29641815-29641837 TAGGTGCAGGCAGAGTGGGAGGG - Intergenic
904704381 1:32378972-32378994 GGGGGTCAGGCAGGGTGAAGGGG + Intronic
905029248 1:34870497-34870519 GGCAGGCAGGCAGGGAGAGAAGG - Intronic
905488959 1:38328735-38328757 AGGGTGGAAACAGGGTGAGAGGG - Intergenic
905747624 1:40432470-40432492 AGGGTGCAGGCTGGGTGCGGTGG - Intergenic
905973857 1:42161730-42161752 GTGGTTCAGACAGGGTGAGGAGG - Intergenic
906535219 1:46547677-46547699 GGGCAGCAGGCAGGATGGGAGGG + Exonic
907223144 1:52921675-52921697 GGGGCGCAGGCTGGGAGTGAAGG + Exonic
907505289 1:54913723-54913745 GGGGTGCAGTGAGAGTGAAAGGG + Intergenic
907945973 1:59137087-59137109 GTGGTTCAGGCAGGCTGAGAGGG + Intergenic
909122605 1:71623191-71623213 GGGGTTGAGGCAGGGAGAAATGG - Intronic
910101491 1:83582867-83582889 GGCTTGAAGGCAGGGTGATATGG + Intergenic
911209153 1:95121318-95121340 GTAGTGCAGGGAGGGTGAGTAGG + Intronic
912551366 1:110487538-110487560 GGGGTGCAGGGAGGTAGAGTAGG - Intergenic
912582698 1:110734785-110734807 GGGCTGCAGAGATGGTGAGATGG + Intergenic
913601061 1:120421478-120421500 GGGAGGAAGGCAGGGAGAGAGGG - Intergenic
915166576 1:153951402-153951424 GGGGTAGAAGCAGGGTAAGAGGG + Exonic
915277017 1:154796050-154796072 GTGGTGCAGAAAGGGTGAGGAGG + Intronic
915722123 1:157993327-157993349 GGGAGGCAGGGAGGGAGAGAGGG + Intronic
915835683 1:159173037-159173059 GGGATGGAGGAAGGGGGAGAGGG + Intronic
916097052 1:161360591-161360613 GGGGTAGGGGCTGGGTGAGATGG + Intronic
916139033 1:161677380-161677402 GGGGAGAAGGGAGGGGGAGATGG - Intronic
916412575 1:164560000-164560022 GAGGCGCAGGCCAGGTGAGATGG + Exonic
916430116 1:164719901-164719923 TGTTTGCAGGCAGGGTGAAATGG - Intronic
916490810 1:165300815-165300837 GAGAAGCAGGCAGGGTGAGAAGG - Intronic
917003522 1:170386507-170386529 GGGCAGGAGGCAGAGTGAGATGG - Intergenic
917931381 1:179824918-179824940 AGGGGCCAGGCAGGGTGGGAGGG - Intergenic
917981877 1:180274588-180274610 GGGGGGCAGGTAGGGTGGGGAGG - Exonic
917988589 1:180348397-180348419 GGGGTTCAGGCTGAGTTAGAAGG + Intronic
918332564 1:183473120-183473142 GGAGGGCAGACAGGGGGAGAGGG + Intronic
918576143 1:186062822-186062844 GGGGACTAGGAAGGGTGAGAGGG - Intronic
919742421 1:200988985-200989007 GGGGTGCAGGTTGTGTGATATGG - Intronic
919843159 1:201623614-201623636 GGGGAGCAGGCAGGGAGGGAAGG + Intronic
920026869 1:203005508-203005530 TGGGTGCAGGCGGGCTGAGTCGG + Intergenic
920098896 1:203504561-203504583 GGTGTGCAGGTAGGGGGAGCTGG - Intronic
920118139 1:203635916-203635938 GGGGAGCAGTGAGGGTGGGAAGG - Intronic
920291207 1:204924287-204924309 AGGCTGCAGGGAGGGAGAGAAGG + Intronic
920398278 1:205661823-205661845 TGGGTGGAGTCAGGGTGGGAGGG - Intronic
920452807 1:206072938-206072960 GGGGTTGAGGCGGGGTGAGGGGG - Intronic
920649213 1:207824245-207824267 GAGGTGCAGGAGGGGTGAGGTGG - Intergenic
920723337 1:208410594-208410616 TGGGTGCAGGCAGAGAGAGCAGG - Intergenic
920857732 1:209676428-209676450 GGGAAGCAGGGAGGGTGAGCAGG + Intergenic
921460512 1:215420850-215420872 GGGCTGCAGGGAGGGGGAAATGG - Intergenic
921555726 1:216596525-216596547 GGAGTGCAGGGAGGGAGAGTGGG + Intronic
922603764 1:226876022-226876044 GGGGTGCAGGGGGTGGGAGACGG + Intronic
924011833 1:239673243-239673265 GGGATGGAGGGAAGGTGAGAAGG + Intronic
924319009 1:242828554-242828576 GGGGTCCAGGCAGAATGAAAAGG + Intergenic
924421838 1:243917224-243917246 GGCGTGCGGGGAGAGTGAGAAGG - Intergenic
924611299 1:245575980-245576002 GAGGTGCAGGCATGGTGGGTGGG - Intronic
924623837 1:245684611-245684633 GGGGTCCAGGCTGGGTGACCAGG - Intronic
1063364043 10:5479060-5479082 GCAGTGCAGCCAGGGTGTGAGGG - Intergenic
1063379593 10:5575970-5575992 TGGGTGGGGGCCGGGTGAGAGGG + Intergenic
1063450365 10:6146185-6146207 TGGGTGCGGGAAGGGAGAGACGG - Intronic
1064248354 10:13687743-13687765 GGGGAGCAGGCAGGGTGCATTGG - Intronic
1064289497 10:14020765-14020787 GTGGTTCAGGCAGGGAGTGAAGG + Intronic
1064414466 10:15136446-15136468 GGGGAGGAGGGAGGGAGAGAGGG + Intronic
1064580377 10:16787390-16787412 GGGGCCCAGGCAGAGTGAGGAGG - Intronic
1064637583 10:17385447-17385469 TGGGTGCAGGCGGAGTGAGTCGG + Intronic
1064795527 10:19007538-19007560 GGGGAGCAGAGGGGGTGAGATGG - Intergenic
1065008704 10:21402701-21402723 TGGATGCAGGCAGGGAGAGGTGG - Intergenic
1065326889 10:24557196-24557218 GGGGTGCAGGCTGGGGGACGAGG + Intergenic
1065508994 10:26458437-26458459 GGGATGGAGGGAGGGAGAGAGGG + Intronic
1065709343 10:28500442-28500464 GGGGAGGAGGAAGGGAGAGAGGG + Intergenic
1065856946 10:29838821-29838843 GGGGTGCAGGAAGGAAGGGAGGG + Intergenic
1065968018 10:30784499-30784521 TGGGGGCAGGCGGGGGGAGAGGG - Intergenic
1067243151 10:44513436-44513458 GGGTTGCAGGAAGGTTGAGAAGG + Intergenic
1067277929 10:44851031-44851053 GAGGTGCACTTAGGGTGAGAAGG - Intergenic
1067662638 10:48247877-48247899 GGGGTCCTGGCAGTGTAAGAAGG + Intronic
1067758080 10:49020767-49020789 GGGAGGCAGGGAGGGAGAGAGGG + Intronic
1067830750 10:49610023-49610045 GGGGGGCAGGCAGGGGGCGGGGG + Intronic
1067849851 10:49747483-49747505 GTGGGGAAGGCAGGGAGAGAAGG + Intronic
1068316528 10:55351010-55351032 GGGGAGGAAGCAGGGAGAGAGGG - Intronic
1068593980 10:58882719-58882741 GGGGTGCAGACAGGGATAAAAGG + Intergenic
1068771361 10:60825348-60825370 GGGGTGCTGCCCGAGTGAGATGG - Intergenic
1068889441 10:62133525-62133547 GGAATTCAGGCAGGGTGATACGG + Intergenic
1068962223 10:62878040-62878062 GGGGTGGGGGCAGGGTGAGGTGG - Intronic
1069885055 10:71618421-71618443 GGGGAGGAGGCAGGCTGAGAGGG - Intronic
1069917859 10:71798329-71798351 GTGGTGGAGGCAGGGAGTGAGGG - Intronic
1069919030 10:71805311-71805333 GGGACACAGGCAGGGTGACATGG - Intronic
1069993502 10:72329003-72329025 AGGCTGCAGTCAGGGTGGGAGGG + Intergenic
1070182261 10:74025666-74025688 GGGAGGCAGGGAGGGAGAGAGGG + Intronic
1070814464 10:79314058-79314080 GGAGTGCAGGCAGGGTAGGCTGG - Exonic
1071385546 10:85116613-85116635 GATGGGGAGGCAGGGTGAGAGGG - Intergenic
1072011508 10:91306348-91306370 GGGGTACAGACATGGAGAGAAGG + Intergenic
1072743762 10:97926038-97926060 GGACAGCAGGCAGGGAGAGAGGG - Intronic
1072755781 10:98019840-98019862 GGGGCTCAGGCAGGTGGAGAGGG - Intronic
1073459377 10:103657850-103657872 GAGATGCAGGCTGGGTGAGATGG - Intronic
1073480669 10:103784344-103784366 GGGGTTCAGGTAGGCTGGGAAGG - Intronic
1075345527 10:121679390-121679412 GGGCTGAAGGCAGGTTGAAAAGG + Intergenic
1075402521 10:122171347-122171369 GGGGTGGAGGTAGGGTGGGGTGG + Intronic
1075440985 10:122479266-122479288 GGGCTGGAGGCTGGCTGAGAAGG + Intronic
1075511303 10:123074709-123074731 GTGGTTCAGGCAGGGGGAGGTGG - Intergenic
1075684743 10:124355662-124355684 GGGGTGGGGGCAGGGAGAGGGGG + Intergenic
1075717834 10:124567075-124567097 GGGGTGCAGGCCAGCTGAGGGGG + Intronic
1075872685 10:125782228-125782250 GGGGAGAAGGCAGTGCGAGAAGG - Intergenic
1076391808 10:130109183-130109205 AGGGTGCAGGCAGGGAGGCAAGG - Intergenic
1076487626 10:130835046-130835068 GGGAAGCAGGCAGAGAGAGAAGG + Intergenic
1076569604 10:131424102-131424124 GGGATGCAGGGAGGCTGAGGTGG - Intergenic
1076793359 10:132787776-132787798 GGGGGGCGGGCAGGGGGAGTTGG + Intergenic
1077063108 11:626354-626376 GGGGGGCAGGATGGGGGAGAGGG - Intergenic
1077284131 11:1758394-1758416 GAGGCCCAGGCAGGGTGACAAGG + Intronic
1077307030 11:1873060-1873082 GAGGTGGAGGCAGGGAGAGATGG + Intronic
1077515644 11:3000432-3000454 GGTGTGGAGGCAGGGTGGCAAGG + Intergenic
1078265846 11:9755971-9755993 GGGGGAGAGGCAGGGTGAAATGG - Intergenic
1078384331 11:10874604-10874626 GGGGTGGGGGAAGGGTGGGAGGG - Intergenic
1079386075 11:19981021-19981043 GGAGGGCAGGCAGAGTGATAAGG - Intronic
1080042070 11:27769471-27769493 AGGGTGCAGAAAGGGTGGGAGGG + Intergenic
1080050717 11:27856151-27856173 GGGGTACAGGGTGGGTAAGAGGG + Intergenic
1080571714 11:33563068-33563090 GGGGGACAGGCCGGGTGTGATGG + Intronic
1080600934 11:33820092-33820114 GGGCTGCAGGAAGGGGCAGAGGG - Intergenic
1081181463 11:39990467-39990489 GGGGTGGGGGAAGGGAGAGAGGG - Intergenic
1081686463 11:45046722-45046744 GACGAGCAGGCAAGGTGAGAAGG + Intergenic
1081856060 11:46304694-46304716 GGGGGGCGGGCAGGGTGACAGGG + Intronic
1082266280 11:50121908-50121930 GGGGTGGAGGGAGGGGGGGAGGG + Intergenic
1082289809 11:50356664-50356686 GGGGTGGAGGGAGGGGGGGAGGG - Intergenic
1082814771 11:57500713-57500735 GGGGTGAGGGCAGAGTGAGTGGG - Intronic
1083114087 11:60441278-60441300 GGGGTGGAGGGAGGGGGGGAGGG + Intronic
1083126795 11:60577175-60577197 GGGGTGTAGGTAGGGAGAGTCGG + Intergenic
1083306786 11:61765721-61765743 CGGGTGCAGGCCGGGCGAGGGGG - Intronic
1083332309 11:61904672-61904694 GGGAGGCAGGCAGGGTGGTAAGG + Intronic
1083619232 11:64040773-64040795 GGGGTGCAGGCAGAGGGAGAAGG + Intronic
1083775571 11:64892990-64893012 AGGATGCAGTCAGGGTGGGATGG + Intergenic
1083802264 11:65053462-65053484 GGGGTGCAGGCAGCAAGAGGAGG + Intronic
1083988666 11:66233282-66233304 GGGGTCCAGGCAGGGAGGCAGGG - Intronic
1084174234 11:67415453-67415475 ACGGAGCAGGCAGGGAGAGACGG - Intronic
1084303294 11:68265107-68265129 GGTGGGCAGGCAGGTGGAGAGGG + Intronic
1084373972 11:68763693-68763715 GAGGTGCTGGCAGCGGGAGAGGG + Intronic
1084376251 11:68779833-68779855 CAGGTGCAGGCAGGGGGACAGGG + Intronic
1084519782 11:69656167-69656189 GGGGCTCAGGCAGGGTGGCAGGG + Intronic
1084546282 11:69816671-69816693 AGGGTGCAGGCAGCGTCAGCAGG - Intronic
1084607187 11:70179270-70179292 AGGGTGCAGTTAGGGTGAGGCGG + Intronic
1084694852 11:70746975-70746997 GGGGTGCAGGGATGGAGGGAGGG - Intronic
1084793508 11:71489748-71489770 GAGGGTCAGGAAGGGTGAGAAGG + Intronic
1084907419 11:72358798-72358820 GGGGTGGAGGAGGGGTGGGATGG - Intronic
1084960591 11:72714193-72714215 GGGGGGCAGGGAGGTGGAGAGGG + Exonic
1085029000 11:73258395-73258417 GGGGTGCAGGCAGGGCCATCAGG + Intergenic
1085050629 11:73378213-73378235 GGGGTTCATGCAGGGTGGGGTGG + Intronic
1085251689 11:75148156-75148178 GGGGTGTGGGCGGGGTGAAAAGG - Intronic
1085990427 11:81836334-81836356 GTGGTGCAGGGACAGTGAGATGG - Intergenic
1088576541 11:111277704-111277726 GGGAAGCAGGCAGGAAGAGAAGG + Intronic
1088846618 11:113673753-113673775 GTGCTGCAGGCAGGAGGAGATGG - Intergenic
1088894066 11:114064624-114064646 TGGGAGCAGCCAGGGTGTGAAGG - Intronic
1088958266 11:114633604-114633626 GGGCTGGGGGCAGGGTGGGAGGG - Intergenic
1089396965 11:118142441-118142463 GGGGTGCCAGCAGGGTGAATAGG - Intronic
1089785339 11:120903448-120903470 AGGGTGGAGGCAGGGTGGGGCGG - Intronic
1089786445 11:120910760-120910782 CGGGTGAGAGCAGGGTGAGAAGG + Intronic
1089813221 11:121148431-121148453 GGGGGTCAGGCTGGGGGAGAGGG + Intronic
1089869202 11:121657208-121657230 GAGGTGCAGGCAGGGGGAAGGGG - Intergenic
1089953031 11:122547522-122547544 GGGGTAGAGGCAAGGAGAGAAGG - Intergenic
1090201592 11:124861635-124861657 GGGGTCCAGGCAGAGAGTGATGG + Intergenic
1090259991 11:125312609-125312631 GGGTGGCAGGCAGGGTGCGGTGG - Intronic
1090428614 11:126627754-126627776 GGGGTGTTGGCAGGATTAGAGGG + Intronic
1090935905 11:131342062-131342084 GAGGTGCAGGCAGGCAGAGGGGG + Intergenic
1091121350 11:133060545-133060567 TAGGTGCAGGCAGGGTGTGGAGG + Intronic
1091301509 11:134510793-134510815 GGGGTGAAGGCTGGGTGAGCAGG - Intergenic
1091434949 12:464998-465020 GAGATGCAGGCAGGGAGAGAGGG + Intronic
1091621152 12:2090082-2090104 GGGCTGGAGGCAGGGAGAAATGG - Intronic
1091697996 12:2640933-2640955 GGGTTGCAGGCCGAGAGAGAGGG - Intronic
1091807558 12:3366754-3366776 TGGGTGCAGGCAGGGACAGCTGG - Intergenic
1092117847 12:6022142-6022164 GGAGTGCAGGCAGGAGGAGTTGG - Intronic
1092161383 12:6317257-6317279 GGGGAGCAGGCATGGGGAGAAGG - Intronic
1092395427 12:8121788-8121810 GGAGTGCAAGCAGGGTGAGGAGG + Intergenic
1092698579 12:11201750-11201772 AGGGTGGAGGGAGGGAGAGAGGG + Intergenic
1092724050 12:11467639-11467661 TGGGTGCAGGCAGGCTGAGTCGG + Intronic
1092912003 12:13153751-13153773 TGGGTGAAGGAAGGGAGAGAAGG - Intergenic
1093765224 12:22954459-22954481 GGAATGCAGGCCGGGTGAGGTGG + Intergenic
1094189304 12:27681014-27681036 GGGGTGGGGGCAGGGTGCGGAGG - Intronic
1094395300 12:29998936-29998958 GGGGAGGAGGCAGCATGAGAAGG + Intergenic
1094492493 12:30969791-30969813 GGGCACAAGGCAGGGTGAGAAGG + Intronic
1094602298 12:31920040-31920062 GGAATTCAGGCTGGGTGAGATGG + Intergenic
1094700958 12:32870310-32870332 GCGGTGCAGGTGGGGTGATAAGG + Intronic
1094818133 12:34205891-34205913 GGGGCGCAGGCAGGTGGAAAAGG - Intergenic
1095212513 12:39510244-39510266 GGGGTGGTGCCAGGCTGAGAGGG - Intergenic
1095393712 12:41739948-41739970 GGGGGGCAGACAGAGAGAGAGGG - Intergenic
1095970108 12:47895898-47895920 GGGATGCAGACCCGGTGAGATGG - Intronic
1096005637 12:48168821-48168843 GAGGTGCAGGCAGAGTGGGCAGG + Intronic
1096233454 12:49910301-49910323 GTGGTGCAGGCTGGGTGTGCGGG - Intergenic
1096652183 12:53067268-53067290 GGAGGGCAGGCAGGGGGAGGTGG + Intronic
1096843668 12:54393571-54393593 GGGGTGCAGGGAGGGGGAGGGGG - Intergenic
1096914467 12:55017036-55017058 GGGGTGAGGGCTGGGGGAGAAGG - Intergenic
1096993413 12:55823307-55823329 GGGGTGGAGGCTTGTTGAGATGG - Intronic
1097223245 12:57462362-57462384 AGGGTGAGGGCGGGGTGAGATGG - Intronic
1097542405 12:60956701-60956723 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
1097608146 12:61781207-61781229 GGGGAGCAGGAAGCCTGAGAAGG + Intronic
1097959608 12:65519601-65519623 GGGGGGCAGGCAGTGGGGGATGG + Intergenic
1098029129 12:66236259-66236281 TGGGTTCAGGCCGGGTGAGGTGG + Intronic
1098906914 12:76171658-76171680 GGAGTGGAGGATGGGTGAGAGGG + Intergenic
1100215024 12:92438789-92438811 GGGATGAAGGCAGAGGGAGAGGG - Intergenic
1100370770 12:93966942-93966964 GGGATGAAGGGAGGGAGAGAGGG - Intergenic
1100381073 12:94062520-94062542 GGGGTGGAGGCAGAGCAAGATGG + Intergenic
1100602378 12:96122905-96122927 GGGCTGCAGGCAGGGTGGATAGG - Intergenic
1100940074 12:99716090-99716112 GGGGTAGAGACAGGGAGAGAAGG - Intronic
1101339010 12:103824760-103824782 GGGGTGGAGGGAGGGTGGGCTGG - Intronic
1102056973 12:109903924-109903946 GGCATGCATGCTGGGTGAGAGGG - Exonic
1102348193 12:112172865-112172887 GGGGTGGGGACAGGGGGAGAGGG + Intronic
1102507692 12:113394071-113394093 TGGGGGCAGGGAGGGAGAGAAGG + Intronic
1102596795 12:113999078-113999100 GGAGTGGAGGCAGGGAGACAGGG + Intergenic
1102619277 12:114181162-114181184 GGGCTGCAGGGAGGGTCAGGTGG - Intergenic
1102932434 12:116872865-116872887 GGGAGGCAGGCAGGGAGGGAGGG + Intronic
1103202682 12:119101179-119101201 GGTCTGAAGGCAGGGTGAGCAGG + Intronic
1103568657 12:121830046-121830068 GGGCTGCAGGCAAGGTGGGGGGG - Exonic
1103736900 12:123066323-123066345 CTGGTGCAGGCAGGGGCAGAGGG + Intronic
1103763529 12:123267151-123267173 GGGGTGATGGCATGGTGGGAGGG - Intronic
1104414822 12:128589391-128589413 GGGAGGCAGGCGGGGTGAGAGGG - Intronic
1104482454 12:129119889-129119911 GGGGTGCTGGCAGGAGGGGAAGG + Intronic
1104689322 12:130813565-130813587 GGGCTGCAAGCAGGGGGCGATGG + Intronic
1104942150 12:132400220-132400242 GGGATGCAGCCAGGGCCAGAGGG - Intergenic
1104952109 12:132445806-132445828 GGGGTGGAGGCAGGTGGAGCGGG - Intergenic
1104968398 12:132520186-132520208 GGGGTGCAAGGAGGGTGTGCTGG - Intronic
1106014636 13:25857130-25857152 GGGCTGCAGGCACTGGGAGAAGG - Intronic
1106633399 13:31501254-31501276 GGAGAGCAGGCATGGTGATATGG + Intergenic
1108196988 13:48004666-48004688 TGGGTGCAGGCGGGCTGAGTCGG + Intergenic
1108584970 13:51863214-51863236 TGGGTGCAGGCTGGGTAGGAAGG + Intronic
1109184925 13:59256948-59256970 GGCGAGAAGGCAGGGTGGGAGGG + Intergenic
1110308800 13:74022691-74022713 TGGCTGCAGGTGGGGTGAGAGGG - Intronic
1111407771 13:87832261-87832283 GAGTTGAATGCAGGGTGAGAAGG + Intergenic
1111996728 13:95172931-95172953 GGGATGGAGGGAGGGAGAGAGGG + Intronic
1112079240 13:95950127-95950149 GGGCAGGATGCAGGGTGAGAGGG + Intronic
1112199266 13:97259449-97259471 GGGATTCAGGGAGGGTGAAAAGG - Intronic
1112314750 13:98351112-98351134 GGGCTGGAGGCAGAGGGAGAGGG - Intronic
1112623742 13:101078801-101078823 GGGGTCCAGGCAGAATGATATGG + Intronic
1112795010 13:103047502-103047524 GGGAGGAAGGCAGGGAGAGAAGG - Intronic
1113510525 13:110850843-110850865 GGGCTGGAGGCAGGGAGAGGAGG + Intergenic
1113602785 13:111582598-111582620 GGGCTGCAGAAAGGATGAGATGG - Intergenic
1113676305 13:112209909-112209931 GGGGTGCAGGCAGGGGCAGTTGG + Intergenic
1113929124 13:113957197-113957219 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929170 13:113957389-113957411 GGGGTGCAGGCAGAGTGCGGGGG - Intergenic
1113929184 13:113957438-113957460 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929208 13:113957534-113957556 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929221 13:113957583-113957605 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929233 13:113957631-113957653 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929265 13:113957776-113957798 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929311 13:113957970-113957992 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1113929323 13:113958019-113958041 GGGGTGCAGGCAGAGTGTAGGGG - Intergenic
1113929361 13:113958165-113958187 GGGGTGCAGGCAGAGTGCAGGGG - Intergenic
1114227392 14:20751761-20751783 GGGGTGCAGTCATGGGGACAGGG - Intergenic
1115154536 14:30323039-30323061 GGCAGGCAGGGAGGGTGAGAAGG - Intergenic
1115419797 14:33181271-33181293 GGGGATCAGGCAGAGTGAGGAGG + Intronic
1115842976 14:37492852-37492874 GGGTGGCGGGGAGGGTGAGATGG - Intronic
1115904559 14:38191579-38191601 GGGGTAGAGACAGGGAGAGAAGG - Intergenic
1116290012 14:43022475-43022497 GGGGTGGAGGAAGGGAGGGAAGG - Intergenic
1116766396 14:49075682-49075704 GGGGTGGAGGCAGGTAGAGATGG + Intergenic
1117955696 14:61122005-61122027 AGGGGGCAGGCAGAGGGAGATGG + Intergenic
1118441855 14:65819928-65819950 GGGGTGGAGGCAGGATGAACCGG + Intergenic
1119771250 14:77221573-77221595 GGGGGGCAGGCTTGGTGGGAGGG - Intronic
1119779763 14:77270243-77270265 GGTGTGCAGGCCGGGTGGGAAGG - Intronic
1120788363 14:88557172-88557194 GTCTAGCAGGCAGGGTGAGAAGG - Intergenic
1120982314 14:90300943-90300965 GGCAGGCAGGCAGGGTGGGAGGG + Intronic
1121795032 14:96727705-96727727 GGGAAGCAGGCAGGGTCACATGG + Intergenic
1122021283 14:98839968-98839990 GGGGTTCAGGCAGGAAGAGCTGG + Intergenic
1122286080 14:100653729-100653751 AGGTTGCAGGGAGGGTGACATGG - Intergenic
1122339887 14:101021096-101021118 GAGGTGCAGGCAGGGTGCTGTGG + Intergenic
1122402697 14:101476632-101476654 GGGAAGGAGGCAGGGAGAGAAGG + Intergenic
1122596881 14:102899769-102899791 GGGGTGCAGGCAGGGGGTCAAGG + Intronic
1122810322 14:104284516-104284538 GGGGTGCAGGCAGGAGGGGAGGG + Intergenic
1122825748 14:104369652-104369674 GGGGTGAGGGGAGGGAGAGATGG - Intergenic
1122873551 14:104652273-104652295 GGGGAGCAGCCATGGTGGGAGGG - Intergenic
1122915578 14:104856879-104856901 GGGGTGCAGGGCGGGTCAGAGGG - Intergenic
1123079456 14:105685439-105685461 AGGGTGCAGCCCGGGTGACAGGG - Intergenic
1202829037 14_GL000009v2_random:5955-5977 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1202900760 14_GL000194v1_random:35807-35829 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1124021952 15:25933402-25933424 GGAGTGAAGGCAGAGAGAGAGGG - Intergenic
1124164661 15:27314892-27314914 GGGCTGCAGGGAGGGAGAAATGG + Intronic
1124626136 15:31308496-31308518 GGGGTGCAGGCAGGGGAGGGTGG - Intergenic
1124956970 15:34366452-34366474 TGGGGGCAGGGAGGCTGAGAGGG - Intronic
1125534799 15:40436741-40436763 GGGGTGTGGGCGGGGTGAGAAGG + Intergenic
1126506551 15:49411008-49411030 GGGGGGTGGGCAGGGAGAGAGGG + Intronic
1126709974 15:51444097-51444119 GGGGTGGAGGGAGGGTGGCACGG + Intergenic
1128128707 15:65211386-65211408 GGGGTGCAGGGATGGGGTGAGGG + Intronic
1128511691 15:68317428-68317450 GGGGTGCAGGCTGGGGGTGAGGG - Intronic
1128571100 15:68733470-68733492 GTGGTGCAGGGAGTGGGAGAGGG - Intergenic
1128729867 15:70013886-70013908 GGAGTGTGGGCAGGGAGAGAGGG + Intergenic
1128793423 15:70449184-70449206 GGGATGGAGGGAGGGAGAGATGG + Intergenic
1128793432 15:70449208-70449230 GGGGTGGAGGGAGGGAGAGATGG + Intergenic
1128793440 15:70449232-70449254 GGGATGGAGGGAGGGAGAGATGG + Intergenic
1128942513 15:71800192-71800214 GGAATGGAGGCAGGGTGACATGG - Intronic
1129058187 15:72837158-72837180 GGTGTGCAGCCAGGGTGGGGAGG - Intergenic
1129306420 15:74667436-74667458 GGGGAGGAGGGAGGGGGAGAGGG + Intronic
1129679598 15:77650722-77650744 GGGGTGAAGGCAGGGGCTGAAGG + Intronic
1129692756 15:77723138-77723160 GGGGTGGGGGCGGGGTGGGATGG - Intronic
1129940730 15:79494748-79494770 GGGGTGGAGGAAGTGGGAGAAGG + Intergenic
1130126719 15:81100107-81100129 GGGATGCAGACAGGCAGAGAAGG - Intronic
1130355480 15:83126087-83126109 GGGGTGCATGCAAGGTGGGTAGG + Intronic
1130668577 15:85890545-85890567 GGGCTTGAGGCAGGGAGAGAGGG - Intergenic
1130781596 15:87045454-87045476 TGGGTGCAGGCGGGCTGAGTCGG - Intergenic
1130797865 15:87229933-87229955 GGGGTGGGGGGAGGGTGGGAGGG - Intergenic
1130854867 15:87832101-87832123 GGGGTAGAGGCAAGGAGAGAAGG - Intergenic
1130900623 15:88204617-88204639 AGGGTGCAAGCAGGGTGCAAAGG - Intronic
1131091810 15:89629298-89629320 GGGGTGCAGGGCGGGGAAGATGG + Intronic
1131157576 15:90084586-90084608 GGGGTGTGGGCAGGGTCGGAAGG + Intronic
1131174909 15:90203366-90203388 TGGGAGAAGGCAGGGTGAGATGG + Intronic
1131785466 15:95907003-95907025 GGGGAGCTGGCTGGGAGAGAGGG - Intergenic
1132341797 15:101083568-101083590 GGGTTGAAGGCAGAGGGAGATGG + Intergenic
1132351669 15:101143061-101143083 AGGGTGCAGGCAGGGGCAGGGGG + Intergenic
1132545525 16:531410-531432 GGGGATCAGGCAGGGGCAGAAGG - Intronic
1132928321 16:2445111-2445133 GGCGTGCAGGGAGCGGGAGAAGG - Intronic
1133071958 16:3252559-3252581 GGGGTCCAGGCCGGGTGCGGTGG - Intronic
1133109868 16:3541617-3541639 GTGGTCCAGGCAGGGGGTGACGG - Intronic
1133206896 16:4239367-4239389 GAGGTGGAGGAAGGATGAGATGG + Intronic
1133406236 16:5526720-5526742 TGGATGCAGGCTGGGGGAGAGGG - Intergenic
1133808861 16:9145902-9145924 GGGGAACAGGAAGGGAGAGAGGG - Intergenic
1133937965 16:10284181-10284203 GGGGTGGAGACATGGGGAGAAGG - Intergenic
1133983162 16:10648617-10648639 GGGATGCAGGCAGGGCGTGGTGG - Intronic
1133986751 16:10674754-10674776 GGGCTGCAGGCAGGGTTTGATGG - Intronic
1134568916 16:15274788-15274810 GAGGTGGAGGCAGGAGGAGAAGG + Intergenic
1134733518 16:16481574-16481596 GAGGTGGAGGCAGGAGGAGAAGG - Intergenic
1135084591 16:19465123-19465145 GGGGTCCAGGAAGGGAGGGAGGG - Intronic
1135589528 16:23695165-23695187 GCGGTTCAGGGAGGGTGAGTGGG - Intronic
1135846206 16:25920788-25920810 TTGGTGCAGACAGGGTGACAGGG + Intronic
1135860175 16:26049278-26049300 TGGGTGAAGGCAAGGTGAGGGGG + Intronic
1136994749 16:35181947-35181969 GTGGTCCAGGCAGGGTTTGAGGG + Intergenic
1137019940 16:35414924-35414946 ACAGTGCAGGCAGGGTGGGAGGG - Intergenic
1137587042 16:49669883-49669905 GGGCTGCAGTGAGGGTCAGAGGG + Intronic
1137590422 16:49690023-49690045 GGGGTGCAGGGAGGTGGAGTAGG - Intronic
1137863714 16:51871887-51871909 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1137976759 16:53038668-53038690 GGGGTGCAGGGGGGGTGTGATGG - Intergenic
1138128867 16:54461561-54461583 GGGCTGCATGCAGTCTGAGATGG - Intergenic
1139303095 16:65961931-65961953 GGGAGGCAGGGAGGGAGAGAGGG + Intergenic
1139398247 16:66658263-66658285 GGGAGGCAGGCAGGGAGGGAGGG + Intronic
1139917882 16:70439239-70439261 GGGGCGGAGGGAGGGAGAGACGG - Intergenic
1140076928 16:71708484-71708506 TGGGTGCAGGCGGGCTGAGTCGG - Intronic
1140475122 16:75235865-75235887 GGGGTGCGGGCCGGGTCAAAGGG + Exonic
1140820040 16:78655067-78655089 AGGATGCAGGCCAGGTGAGAAGG - Intronic
1140957421 16:79878147-79878169 GTTGTTCAGGCAGGGTCAGAAGG + Intergenic
1141353752 16:83323743-83323765 GGGGTGCAGGGAGAGTGTGATGG - Intronic
1141663023 16:85451949-85451971 GGGGGGGAGGCAGGCAGAGACGG - Intergenic
1141693164 16:85607697-85607719 AGGGGGCAGGCAGGGAGAGGCGG + Intergenic
1141870064 16:86779153-86779175 GCTGTGCAGCCAGGGTGAGGTGG - Intergenic
1141899792 16:86983727-86983749 GGGGTGGAGGCTGGGGGTGAAGG + Intergenic
1141909237 16:87047263-87047285 GCCCTGCAGTCAGGGTGAGATGG - Intergenic
1141952010 16:87345326-87345348 GGGCGGGAGGCAGGGTGGGAGGG + Intronic
1142106752 16:88308502-88308524 GAGGGGCAGGCTGGGGGAGATGG - Intergenic
1142304721 16:89278804-89278826 GGGGTGCACCCAGGGTGAGGGGG + Intronic
1142744461 17:1948740-1948762 GGGGTCCAGGAGGGGTGTGAGGG + Intronic
1142777701 17:2154200-2154222 GGGATGCACGCAGAGTGTGACGG + Intronic
1143108450 17:4540941-4540963 GGGGTGCTGGCAGGCAGAGGCGG - Intronic
1143178190 17:4968452-4968474 CGGGTGCAGGCAGGAGGAGCTGG + Exonic
1143523472 17:7459534-7459556 CGGGTGGTGGCAGAGTGAGAAGG - Exonic
1143751589 17:9032140-9032162 GGGGTGCAGGGAGGGGCCGAGGG + Intronic
1143971215 17:10797363-10797385 GGGAAGGAGGGAGGGTGAGAGGG - Intergenic
1144626941 17:16848804-16848826 GGGGTGGAGGCTGGGTGGGGGGG - Intergenic
1144739234 17:17571998-17572020 GGGCTCCAGACAGTGTGAGAAGG - Intronic
1144745593 17:17612111-17612133 GGGCAGCAGGCAAGGTGGGAGGG - Intergenic
1144777632 17:17792783-17792805 GGGGAGCAGGCAGGGTGGGGAGG + Intronic
1144814642 17:18025477-18025499 GGGGTGCTGGGAGGGGCAGATGG + Intronic
1144833661 17:18145290-18145312 GGGGTGCAGGGAGGGGGCTAGGG + Intronic
1144879498 17:18423908-18423930 GGGGTGGAGGCTGGGTGGGGGGG + Intergenic
1145152742 17:20520479-20520501 GGGGTGGAGGCTGGGTGGGGGGG - Intergenic
1145768903 17:27478653-27478675 GGGGTGCAGGAAGGGCAAGGAGG - Intronic
1145898079 17:28472269-28472291 TGCGTGCAGTCAGGGTGAGGAGG + Intronic
1146002701 17:29140606-29140628 GGGGGGCAGGCAGTGTTAGGGGG + Intronic
1146283791 17:31560941-31560963 TGGGAGGAGGGAGGGTGAGAGGG + Intergenic
1146597423 17:34182747-34182769 TGGGTGCAGGTAGGTGGAGAGGG - Intergenic
1146945156 17:36868773-36868795 GCAGGGCAGGCCGGGTGAGAGGG - Intergenic
1146997615 17:37334710-37334732 GGGGTGCAGTGAGAGTGAAAGGG - Intronic
1147159742 17:38563032-38563054 TGTGTGCAGGCAGCCTGAGATGG - Intronic
1147427369 17:40352265-40352287 GGGCTGGAGCCAGGCTGAGAAGG + Intronic
1147607793 17:41784287-41784309 GGGGTGGAGCCAGGGTGCAAGGG + Intronic
1147743509 17:42681770-42681792 TGGGGGCAGGGAGGGGGAGAAGG - Intronic
1148071288 17:44910377-44910399 GGGGTGCAGGGAGGGGAAGAGGG + Exonic
1148800787 17:50224290-50224312 TGGGTGCAGGCTGGGTGTGGTGG - Intergenic
1148864420 17:50621070-50621092 GGGCTGCAGGCAGGCGGAGGAGG + Intronic
1148911846 17:50947110-50947132 GGGGTGCAGGCTGGGGAAGGTGG + Intergenic
1148984999 17:51613420-51613442 GGGGTAGAGGGAGGGAGAGAGGG - Intergenic
1149302978 17:55321869-55321891 GGGGGCGAGGCAGGGTGTGAGGG - Exonic
1149862806 17:60133272-60133294 GGGGTGTAGGCTGGCTGACACGG - Intergenic
1150211245 17:63442759-63442781 TGGCTGCAGGTAGGGTGAGTGGG - Intronic
1150293225 17:63993425-63993447 GGGGAGGAGGGAGGGAGAGAAGG + Intergenic
1150381511 17:64723909-64723931 GGGGTGCAGGGAGGGTGGAAAGG + Intergenic
1150461878 17:65360536-65360558 GGTCAGCAGGCAGGGGGAGAAGG + Intergenic
1150741215 17:67780314-67780336 TGGGTGGAGGCAGGGCGAGGTGG - Intergenic
1150774872 17:68073296-68073318 GGGGTGCAGGGAGGGTGGAAAGG - Intergenic
1150826076 17:68476630-68476652 GGGATGGAGGGAGGGAGAGAGGG - Intergenic
1151169759 17:72236627-72236649 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169767 17:72236647-72236669 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169779 17:72236675-72236697 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169787 17:72236695-72236717 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169799 17:72236723-72236745 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169809 17:72236747-72236769 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169821 17:72236775-72236797 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151169835 17:72236807-72236829 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1151574649 17:74946636-74946658 GGGAGGGAGGCAGGGTGGGAGGG - Intronic
1152044926 17:77929528-77929550 GGGCTGCGGGCAGGGTTACAGGG + Intergenic
1152091445 17:78249831-78249853 GAGGTGCAGGCAGAGTCAGAGGG + Intergenic
1152232112 17:79119043-79119065 GGGTTAGAGGTAGGGTGAGAAGG - Intronic
1152252877 17:79220896-79220918 TGGGTGCAGCAGGGGTGAGAGGG + Intronic
1152367197 17:79863146-79863168 GGGCTGCACGCAGGGTCAGCTGG + Intergenic
1152464710 17:80459250-80459272 GGGGTCCAGGCCGGAGGAGAAGG - Intergenic
1152514935 17:80817586-80817608 GGGGAGCAGGCAGAGTGATGGGG + Intronic
1152524568 17:80880120-80880142 GGGGTGCAGGCAGGGGCTGCAGG + Intronic
1152735156 17:81993697-81993719 GGGGTACTGGGAGGGTCAGAGGG - Intronic
1152760267 17:82103842-82103864 GAGGGGCAGGGAGGGTGAGCTGG + Intronic
1153312756 18:3693333-3693355 GGGAGGCTGGCAGGTTGAGATGG - Intronic
1153565188 18:6412278-6412300 GGGCTGGAGGCAGGGTGGAAAGG - Intronic
1154250112 18:12737373-12737395 GGGGTGTACTCAGGGTGACATGG + Intergenic
1154356425 18:13625708-13625730 AGGGTGCTGGCAGGGGGAGGAGG - Intronic
1154360195 18:13654381-13654403 GGGATGATGGCAGGGAGAGAGGG + Intergenic
1155217555 18:23656932-23656954 GAGGTTGAGGCAGGGAGAGAGGG - Intronic
1156315908 18:35968494-35968516 GGGGTGCAGGCAAGAGAAGAGGG + Intergenic
1156392680 18:36665583-36665605 GGGGGGCAGGGAGGTTAAGAGGG + Intronic
1156447701 18:37249391-37249413 GAGGAGCAGGCAGAGTGGGAAGG - Intronic
1156471149 18:37377991-37378013 GGGGCGCAGGGAGGAGGAGAAGG - Intronic
1156492107 18:37502393-37502415 GGGGGGCAGGGAGAGTGGGAGGG + Intronic
1156924248 18:42557173-42557195 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
1156970309 18:43146331-43146353 GGGTTGTAGGCAGGTAGAGAGGG + Intergenic
1157182871 18:45512811-45512833 GGGGAGCTGGAAGGGTGGGAAGG + Intronic
1157722632 18:49937158-49937180 AGGATGGCGGCAGGGTGAGAGGG - Intronic
1157780122 18:50430862-50430884 GGGAGGCAGGCAGGGCCAGAGGG + Intergenic
1157780128 18:50430881-50430903 AGGGTGCAGGCAGGGCCAGAGGG + Intergenic
1158541931 18:58365071-58365093 GGGGAGGAGGCAGGGAGAGATGG - Intronic
1158575030 18:58629499-58629521 GGGGGGTAAGCAGGGTGAGGAGG - Intergenic
1158963843 18:62607090-62607112 GGGGTGCCGTCAGGGTGGGAAGG + Intergenic
1159826918 18:73224287-73224309 TGTGTGCAGGCAGGGAGTGATGG + Intronic
1160416297 18:78713870-78713892 GGAGAGCAGACAGGGAGAGAGGG + Intergenic
1160525234 18:79532038-79532060 GGGCTGCAGGCGGGGTCAGCTGG - Intergenic
1160596049 18:79975103-79975125 GGGCTGCAGGGAGGGTGCTACGG - Intronic
1160700098 19:501945-501967 TGGGGGCAGGGAGGGTGGGAAGG + Intronic
1161033582 19:2071595-2071617 GGGGTTCAGCCAGGGAGAGGAGG + Exonic
1161056202 19:2191713-2191735 GGGATGCAGGGAGGGCGCGAGGG - Intronic
1161329030 19:3677788-3677810 GGGATGCAGGGAGGGAGGGAGGG + Intronic
1161817118 19:6506150-6506172 TGGGTGCAGGCGGGCTGAGTGGG - Intergenic
1162021498 19:7870341-7870363 GGGGGAGAGGCAGGGGGAGAGGG + Exonic
1162021529 19:7870434-7870456 GGGGGAGAGGCAGGGGGAGAGGG + Exonic
1162021598 19:7870656-7870678 GGGGGTGAGGCAGGGGGAGAGGG + Exonic
1162054232 19:8053156-8053178 GGGGTGGGGGCATGGGGAGAGGG - Intronic
1162057177 19:8071686-8071708 AGGGTGCAGGCAGGGTTGGAGGG + Intronic
1162063708 19:8111849-8111871 GGGGGGCAGTCAGGGTTGGAGGG - Intronic
1162070440 19:8149357-8149379 GGGGGGCCGGCAGGGGGAGGGGG - Intronic
1162325525 19:9996712-9996734 GAGGTGGAGACAGGGAGAGAGGG + Intronic
1162483122 19:10941062-10941084 GGGAGGCAGGGAGGGAGAGAGGG + Intergenic
1162522913 19:11192720-11192742 AGGGTCCAGGCAGGGTGCGGTGG - Intronic
1162767250 19:12927310-12927332 TGGGGGCAGGCAGGGTGTGGGGG + Intronic
1162968652 19:14167481-14167503 GGGCAGCAGGCAGGGTGGGAAGG - Intronic
1163470965 19:17496710-17496732 GGGGTGCGGGTAGGGGGAGGAGG + Intronic
1163517806 19:17775382-17775404 GGGCGGTTGGCAGGGTGAGATGG + Intronic
1163607346 19:18282228-18282250 GGGGTGGAGGGAGGGAGGGAAGG - Intergenic
1163644934 19:18483839-18483861 GAGGTGCAGGCAGGGTGGGCAGG - Intronic
1163659535 19:18568519-18568541 GGGGCTCAGGGAGGGCGAGACGG - Exonic
1163672187 19:18636089-18636111 GGGTGGGAGGGAGGGTGAGATGG - Intergenic
1163779967 19:19240938-19240960 GGGGACCAGGCAGAGTGAGTAGG - Intronic
1164647468 19:29870195-29870217 GGGGAGCAGGCAGGGGCAGTGGG - Intergenic
1164683781 19:30153313-30153335 GAGATGCAGGCAGCATGAGAGGG - Intergenic
1164725610 19:30463827-30463849 GGGGTGCAGGCATGGTGGTGTGG + Intronic
1164725674 19:30464226-30464248 GGGGTGCAGGCCTGGGGCGATGG + Intronic
1164781284 19:30895669-30895691 AGGGTGAAGGCAGGGCAAGAAGG - Intergenic
1164843964 19:31416235-31416257 GTGGTGCAGGCAGGGGCAGCAGG + Intergenic
1164976947 19:32580829-32580851 GGGGCGCAGGAAGGCTGAGTGGG - Intergenic
1165245169 19:34494457-34494479 GGTGTGCACACAGGGAGAGAGGG + Intronic
1165397154 19:35570716-35570738 GGGCAGCAGGAAGGGTGGGATGG + Intergenic
1165497303 19:36160662-36160684 TGGGTGCAGGCGGGCTGAGTCGG + Intergenic
1165742156 19:38210875-38210897 AGGGTGCAGGCAGGGGAAGAAGG + Intergenic
1165793352 19:38505278-38505300 GGAGGGGAGGCAGGGTGAGGGGG - Intronic
1165992629 19:39825394-39825416 TGGGGGCAGGTAGGGGGAGATGG - Exonic
1166007584 19:39917848-39917870 GGGGTCCAGGCAGGATGGGGAGG - Intronic
1166040368 19:40198607-40198629 GGGGTGAGGGCAGAGTGGGAGGG + Intronic
1166104163 19:40589437-40589459 GGGGTGGGGTCAGGGTGGGATGG + Intronic
1166304977 19:41932444-41932466 GGGGAGGAGGCAGGGAGGGAGGG + Intergenic
1166359482 19:42247134-42247156 GGGGTGTGGGCAGGGTGCGAGGG + Intronic
1166602915 19:44113712-44113734 GGGGTGCAGGGAGGCCGAGTGGG - Intronic
1166669056 19:44698859-44698881 GGGGTGGAGGGAGGGTAACAGGG - Intergenic
1166706404 19:44910382-44910404 GGGGTGCAGGGTGGGTGGGAAGG - Intergenic
1166781949 19:45347614-45347636 GAGGTGAGGGCAGGGTGAGGAGG + Intronic
1166850369 19:45757238-45757260 GGGGTCCAGGCAGGGAGCCAAGG - Exonic
1166927426 19:46278507-46278529 TGGGTGCAGGCGGGCTGAGTCGG + Intergenic
1167002600 19:46755116-46755138 GGGTTGCAGGCAGGGGGGAATGG - Intronic
1167270098 19:48501624-48501646 GGGGTGGAGTCAGTGTGAAAGGG - Intronic
1167270706 19:48504153-48504175 TAGGTGCAGGCAGGGTGCGGTGG - Intronic
1167385070 19:49158148-49158170 GGGGTGGAAGTGGGGTGAGAGGG - Intronic
1167414900 19:49364838-49364860 GGGGGACAGACAGGATGAGAGGG + Intronic
1167713121 19:51124528-51124550 GGGGTGCAGGTGGGGTGAGCAGG - Intergenic
1167715724 19:51141923-51141945 GGGGTGCAGGTGGGGTGAACAGG - Intergenic
1167721716 19:51184370-51184392 GGGGTGCAAGCGGTGTGAGCAGG - Intergenic
1167762609 19:51458826-51458848 GGGGTGCAGGTGAGGTGAGCAGG + Intergenic
1167769018 19:51502154-51502176 GGGGTGCAGGTGGGATGAGCAGG + Intergenic
1168661885 19:58173788-58173810 GGGGTGCTGGAAGGGAAAGATGG - Intergenic
1202643661 1_KI270706v1_random:121834-121856 GGGGAGGAGGCAAGGTGAGGGGG + Intergenic
924998142 2:382737-382759 GGGGCTCAGGCTGGGTGAGATGG - Intergenic
925166525 2:1719180-1719202 GGGGAGCAGGTGGTGTGAGAAGG - Intronic
925188827 2:1867033-1867055 GAGGGGCAGCCAGGGAGAGAGGG + Intronic
925445724 2:3925176-3925198 GGGTCACAGTCAGGGTGAGATGG - Intergenic
925812475 2:7713977-7713999 GGGGTGAGGGCAGGGGGAGGAGG - Intergenic
925894964 2:8464032-8464054 CGGGTGCAGCCAGGCTGAGGCGG - Intergenic
925948921 2:8893072-8893094 GGGGAGGAGGCAGGGGGAGGGGG + Intronic
926126919 2:10277641-10277663 GGGGTCCAGGCAGAGGCAGAGGG + Intergenic
926647930 2:15310191-15310213 GGGATGGTGGGAGGGTGAGAAGG + Intronic
926712038 2:15889689-15889711 GGGGTTCAGAAAGGGTAAGAAGG - Intergenic
927002764 2:18816061-18816083 GGGGAGCAGGGAGGTGGAGATGG - Intergenic
927348378 2:22074704-22074726 GGGGTGAAGGGAGGTGGAGATGG + Intergenic
927576857 2:24207758-24207780 GGGGAGGAGGCAGGGGCAGAAGG + Intronic
927650776 2:24912367-24912389 GGGGGGCAGCCAGGGGCAGAGGG + Intronic
928174470 2:29024462-29024484 AGGGTGCAGGGAGGGAGGGAGGG + Intronic
928291865 2:30046228-30046250 GGGTTGAAGCCAGGATGAGAGGG + Intergenic
928692628 2:33816704-33816726 GGGATGGAGGGAGGGAGAGAAGG - Intergenic
931223254 2:60307313-60307335 TGGGGGCAGGCTGGGTGTGAAGG - Intergenic
931569783 2:63656447-63656469 GGGCTACAGGCGGGCTGAGAGGG + Intronic
931632891 2:64317203-64317225 GGGGTGGTGGCACGGGGAGAGGG - Intergenic
932446142 2:71782709-71782731 GGGGTGCAGTCTGCGTGGGAAGG + Intergenic
932700392 2:73987430-73987452 TGAGAGCAGGCAGGGTGGGAAGG + Intronic
932759946 2:74432674-74432696 GGGTTGGGGGAAGGGTGAGAAGG + Intronic
932852751 2:75201964-75201986 AGGATGGAGGCAGGGAGAGAAGG - Intergenic
933073874 2:77897545-77897567 TGGGTGCAGGCGGGCTGAGTCGG - Intergenic
933341775 2:81034691-81034713 GGGGAGGAGGCAGAGTAAGATGG - Intergenic
933730933 2:85455848-85455870 GGAGTGGAGGCAGGGTGGGGAGG + Intergenic
933755188 2:85632892-85632914 GAGGTGGAGGCAGGTTGGGATGG + Intronic
933897345 2:86823931-86823953 GGGGTCCAGGCAGAGAGAGGAGG + Intronic
933918332 2:87019012-87019034 GGGCTGCAGGCAGAGGGAGTGGG + Intronic
934004664 2:87750901-87750923 GGGCTGCAGGCAGAGGGAGTGGG - Intronic
934506095 2:94895749-94895771 GGGGAGGAGGCAAGGTGAGGGGG + Intergenic
935604008 2:104951617-104951639 GGGGAGGAGGCGGGGTGGGAGGG - Intergenic
936029917 2:109062805-109062827 GGGGTGCTGGGATGGTGAGGGGG + Intergenic
936846792 2:116844295-116844317 GGGGGGCAGGAAGAGAGAGAGGG - Intergenic
937040668 2:118818226-118818248 GAGGTTGGGGCAGGGTGAGATGG - Intergenic
937131529 2:119517725-119517747 AGGGTGAAGGTTGGGTGAGATGG + Intronic
937282188 2:120726174-120726196 GGGGAGCAGGGAGAGAGAGAGGG + Intergenic
937502777 2:122500290-122500312 GGGAAGGAGGCAGGGAGAGAGGG - Intergenic
938727655 2:134121330-134121352 GGCGAGCAGGCAGGGTGCAAGGG + Intronic
939454593 2:142418003-142418025 GGGGAGGAGGGAGGGGGAGAAGG - Intergenic
940182688 2:150953649-150953671 TGGGTGCAGGCAGGCTGAGTCGG - Intergenic
940454711 2:153882182-153882204 GGGGTCGAGGCAGGGGGAGGTGG + Intronic
940749615 2:157611521-157611543 GGGATGCTGGCAGGGTGGGTGGG + Intronic
941924973 2:170885575-170885597 AGGGTGGAGTCAGGATGAGAGGG - Intergenic
942084526 2:172431526-172431548 GGGGTGGAGGCAGGCAAAGAAGG - Intronic
943185024 2:184597513-184597535 GGGTGGGAGGCAGGGTGGGAGGG + Intergenic
943751585 2:191514932-191514954 GGGGTGGTGGCAGGGGGCGATGG + Intergenic
944264570 2:197709392-197709414 TGGGTGCAGGCGGGCTGAGTCGG + Intronic
946042412 2:216793570-216793592 TGGGTGCATTCAGGGTGATATGG + Intergenic
946058056 2:216918527-216918549 GGGGTGCATGCAAGGAGAGGAGG - Intergenic
946140067 2:217682635-217682657 GGGGTGGAGGAAGGGTTAGCAGG - Intronic
946435108 2:219646184-219646206 GGGGTGCATGGAGGGTAAGGGGG + Intergenic
946812498 2:223540865-223540887 GTGTTGGAGGCAGGGTGTGATGG + Intergenic
947139147 2:227004856-227004878 GGTGGGGAGGCAGGGAGAGAAGG + Exonic
947380450 2:229540311-229540333 GGGGTGCAGGGGTTGTGAGAGGG + Intronic
947524090 2:230868080-230868102 GGGGTGGGGGCAGGGTGAGGCGG + Intronic
947701606 2:232239156-232239178 GTGGTGCAGTCAGGATGAGAGGG - Intronic
947994138 2:234512690-234512712 GAGGCACAGCCAGGGTGAGAAGG + Intergenic
948015639 2:234688479-234688501 GGGATGGTGACAGGGTGAGATGG - Intergenic
948799889 2:240427928-240427950 GGGCTGGAGGCACGGAGAGATGG - Intergenic
1168951860 20:1807861-1807883 GGGGTTCAGTCAGGGTGTAAAGG - Intergenic
1168997801 20:2145843-2145865 GGGCTGCAGCCAGGGAGAGGGGG - Exonic
1169068948 20:2709891-2709913 GGAGGGCAGGGAGGTTGAGAGGG + Intronic
1169506130 20:6213328-6213350 GGGGTGGTGGTAGGGGGAGAGGG + Intergenic
1169664326 20:8018277-8018299 GGGGGGCAGGTAGGGTGGAAAGG + Intronic
1169890106 20:10443558-10443580 TGGGTGAAGGCAGGGAGAGCTGG + Intronic
1170633246 20:18083133-18083155 GGAGTGAAGGCAGGGTGGGCTGG - Intergenic
1171007830 20:21484648-21484670 TGGGTGCATTCAGGGTGATATGG + Intergenic
1171257228 20:23698590-23698612 GAGGTGCAGGTAGGATGAGGTGG + Intergenic
1171264592 20:23760444-23760466 GAGGTGCAGGTAGGATGAGGTGG + Intergenic
1171893628 20:30740785-30740807 GGGGAGGAGGCAAGGTGAGGGGG + Intergenic
1172012959 20:31857068-31857090 GGGGGGCTGGGAGGCTGAGAGGG + Intronic
1172100948 20:32483682-32483704 AGGGCGCAGGCAGGGGGAGTAGG + Intronic
1172434471 20:34919313-34919335 GGAGTACAGGAAGGGAGAGAAGG - Intronic
1172486410 20:35300610-35300632 GGGAGGGAGGCAGGGTGACATGG + Intergenic
1172702977 20:36863811-36863833 GGGACGCAGGCAGGGAGCGAGGG + Intergenic
1173028724 20:39334558-39334580 GGGGGGCAAGCAGGGCTAGATGG - Intergenic
1173063241 20:39681946-39681968 AGGGTGCAGTCAGCGAGAGATGG - Intergenic
1173632233 20:44525276-44525298 GGGGTGGGGGAAGGGTGGGAAGG - Intergenic
1173671304 20:44800921-44800943 TGGGTGGAGGAAGGGTGGGATGG - Intronic
1173838095 20:46138812-46138834 GGGTTGCATTCAGGGTGAGGTGG + Intergenic
1173859708 20:46275189-46275211 GGGGAGCGGACAGGGTGAGAGGG - Intronic
1174056665 20:47802896-47802918 GGGGAGCTGGCGGGGTGGGAGGG + Intergenic
1174189873 20:48732855-48732877 GGGGTGGAGGGAGGGCGGGAAGG - Intronic
1174484626 20:50853425-50853447 GGGGTGTTGGCTGGGTGAGGTGG - Intronic
1174531175 20:51215512-51215534 AGAGGTCAGGCAGGGTGAGAGGG + Intergenic
1174623091 20:51891634-51891656 GGGTTTCAGGCTGGGTGCGATGG + Intergenic
1175144366 20:56884646-56884668 AGGCTGCAGGCTGGGTGTGATGG - Intergenic
1175372223 20:58499696-58499718 GGGGTGGAAGCAGGGTGTGAAGG - Intronic
1175715243 20:61251197-61251219 GGGGTTCTGGGAGGGAGAGAGGG + Intergenic
1175845262 20:62054897-62054919 GGTGGGCAGGCGGGGTGAGAGGG - Intronic
1175904124 20:62371466-62371488 GGGGTGCAGACAGGCTTAGGTGG + Intergenic
1175914776 20:62420788-62420810 GGGAGGCAGGCAGGGAGGGAGGG - Intronic
1175977399 20:62717945-62717967 GGGGTGCAGGCAGGTCAGGAAGG + Intronic
1176025330 20:62982646-62982668 GGGGGCCAGGCAGGGTGAAGTGG - Intergenic
1176078416 20:63259707-63259729 GGGGAGCAGGCTCGGTAAGACGG - Intronic
1176268132 20:64221263-64221285 GGGGTCCAGGAAGGGTCAGAAGG - Intronic
1176548896 21:8213223-8213245 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1176556791 21:8257436-8257458 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1176567827 21:8396258-8396280 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1176575730 21:8440477-8440499 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1176608221 21:8850794-8850816 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1176620134 21:9050585-9050607 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1176733345 21:10521361-10521383 GGGGTGCGGGGAGGGTGGCACGG + Intergenic
1177741401 21:25158485-25158507 GGGGTGGAGGGAGGGAGGGAAGG + Intergenic
1178582078 21:33845958-33845980 GGGGTGCAGGCAGGCAGTGTGGG + Intronic
1179292397 21:40030191-40030213 GAGGAGCAGGGAGGCTGAGAGGG - Intronic
1179794901 21:43776842-43776864 GGGGCCCAGGGAGGGGGAGACGG + Intergenic
1179835098 21:44026198-44026220 GGGGTGGGGGCAGGGAGTGAAGG - Intronic
1179934136 21:44591678-44591700 GGCGTGCTGGCAGGGGGAGGAGG + Exonic
1180001157 21:44996130-44996152 GGGGGGCAGGCAGGGGCAGGCGG - Intergenic
1180004341 21:45013164-45013186 GAGGTGAAGGCAGGGGCAGAGGG + Intergenic
1180188017 21:46150063-46150085 GGCGTGCAGGGAGGGTGGGGAGG - Intronic
1180198334 21:46210443-46210465 GGGCTGGAGGCTGTGTGAGAAGG - Intronic
1180358303 22:11860599-11860621 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1180379959 22:12131731-12131753 GGGGAGGAGGCAAGGTGAGGGGG + Intergenic
1180569282 22:16700556-16700578 GGGGTGCAGGCAGGAGGAGTTGG - Intergenic
1180731102 22:17983264-17983286 GGGGTGCAGGGAGGGTCCCAGGG - Intronic
1181004843 22:20008391-20008413 GGGGAGCTGGGAGGGTGTGATGG - Intronic
1181257019 22:21569105-21569127 GGAGTGCAGGCCGGGCGCGATGG + Intronic
1181317844 22:21982517-21982539 GGGGTTCAGGGAGGTGGAGATGG - Exonic
1181630209 22:24147239-24147261 GGGAGGGAGGCAGGGAGAGAGGG - Intronic
1181692775 22:24574419-24574441 GGGGTAAAGGCAGGGTAGGAGGG - Intronic
1181696214 22:24594056-24594078 TGGCGGCAGGCAGAGTGAGATGG + Intronic
1181877018 22:25947672-25947694 GTGGTCAAGGCAAGGTGAGAGGG - Intronic
1182074850 22:27488465-27488487 GGGGGCCAGGGAGGGTGGGAGGG + Intergenic
1182075849 22:27494980-27495002 GAGGTGAAGGCGGGGTCAGAGGG + Intergenic
1182277560 22:29200304-29200326 GGGGTGGAGGCTGGATGGGATGG + Intergenic
1182620254 22:31614879-31614901 CGTGGGCAGGCAGGGGGAGATGG + Intronic
1182855714 22:33516083-33516105 AGGATGCAGGGAGGGTGTGAGGG + Intronic
1183065323 22:35358747-35358769 GGGGGGCTGGCCAGGTGAGATGG - Intergenic
1183136612 22:35895052-35895074 GGGACGGAGGGAGGGTGAGAGGG - Intronic
1183245647 22:36691297-36691319 GGGCAGAAGGCAGGGGGAGAGGG + Intronic
1183285961 22:36964216-36964238 GAGGAGCATGCAGGATGAGAGGG - Intergenic
1183617632 22:38955023-38955045 GGGGTCCAGACTGGGTGAGAGGG - Intronic
1183633864 22:39049260-39049282 GGGATGCTGGCAGGGGCAGAAGG - Intronic
1183720668 22:39559821-39559843 GAGGGGCATGCAGGGTGAGGAGG - Intergenic
1183960723 22:41410415-41410437 GCAGGGCAGGTAGGGTGAGATGG + Intergenic
1184098552 22:42329660-42329682 GGGATGCAGGAGGGCTGAGAGGG + Intronic
1184249821 22:43253710-43253732 GTGGTGCAGGCGGGGGGAGGAGG - Intronic
1184279578 22:43429316-43429338 GGAGTGCAGGGAGGGGGACAAGG + Intronic
1184479933 22:44740431-44740453 GGGGTGCAGTCAGGGTCACTGGG - Intronic
1184981019 22:48096216-48096238 GAGGTGCAGGCGGGGTGGGGAGG + Intergenic
1184981026 22:48096235-48096257 GAGGTGCAGGCAGGGTGGGGAGG + Intergenic
1184981034 22:48096254-48096276 GAGGTGCAGGCGGGGTGGGGAGG + Intergenic
1203253781 22_KI270733v1_random:129531-129553 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1203261837 22_KI270733v1_random:174610-174632 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
949253886 3:2021287-2021309 GGGGTCCTGGCATGGTGTGAGGG - Intergenic
949351442 3:3127762-3127784 GGGCTTCAGGCAGTATGAGAGGG - Intronic
950031493 3:9856836-9856858 AGGGTGGAGGAAGGGGGAGATGG - Intergenic
950105258 3:10384600-10384622 GGGGTGGAGGGTGGGGGAGAGGG - Intronic
950128106 3:10523238-10523260 GAGGTGCAGGCAGGTTGAGTAGG + Intronic
950719754 3:14874550-14874572 GGGGTGGAGGGAGGGAGAGGTGG + Intronic
951376846 3:21928413-21928435 GGGATGCAGGGAGGGAGAGAGGG + Intronic
951838216 3:27005076-27005098 GGGGTGCAGTGAGAGTGAAAGGG - Intergenic
952497676 3:33929969-33929991 GGGATGCTGGCAGGGTGGGATGG + Intergenic
952537853 3:34332761-34332783 GGGGGGGAGGCAGGGAGGGAGGG - Intergenic
952851777 3:37735312-37735334 GGGGGGCAGGCATGGAGACAGGG - Intronic
953277455 3:41516703-41516725 GGGGTGGGGGAAGGTTGAGATGG + Intronic
953404195 3:42652558-42652580 GGGCTGGAGGTTGGGTGAGAAGG - Intergenic
953863267 3:46563405-46563427 GGGGAGCAGGAGGGGTGAGGTGG - Intronic
953961715 3:47271185-47271207 GGGTGGCAGGGAGGGAGAGAAGG + Intronic
954219083 3:49141724-49141746 CTGGTGCAGGCAGAGAGAGATGG - Intergenic
954384015 3:50235099-50235121 GGCGGGCAGGCAGGGTGAGGGGG - Intronic
954438860 3:50510727-50510749 GGGGTGGAGGCAGGGCCAGGAGG + Intergenic
954968784 3:54634552-54634574 TGGGTGCAGGCGGGCTGAGTCGG + Intronic
955228653 3:57080304-57080326 CAGGTGCAGGAAGGGTGTGAGGG + Intergenic
956050101 3:65238604-65238626 GGGGTGAAGACAGGGAGGGAGGG - Intergenic
956416148 3:69032186-69032208 GGGCTGCTGTCATGGTGAGAGGG - Intronic
957942566 3:87023068-87023090 GGGGTGGGGGCAGGGGGGGAGGG + Intergenic
958058712 3:88449072-88449094 GGGAGGCAGGGAGGGAGAGAAGG - Intergenic
958182029 3:90072374-90072396 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
958693411 3:97497483-97497505 GGAATAAAGGCAGGGTGAGAGGG - Intronic
960386110 3:117023766-117023788 GGGGGGAAGGAAGGGAGAGAAGG - Intronic
960702366 3:120451029-120451051 GGGGGGCAGGCAGGCGGGGAAGG - Exonic
960711882 3:120538387-120538409 TGAGGGCAGGCAGGGTGGGAAGG - Intergenic
961185584 3:124912323-124912345 GGGGTTCTGGAAGGGTGAGGGGG + Intronic
961264072 3:125626209-125626231 GGAGTGCAGGAAGGGTAAGCAGG - Intergenic
961431464 3:126886909-126886931 GGGGTGAAGGGAGGGTGGAAGGG - Intronic
961653560 3:128429319-128429341 GCGGTGGAGGCAGGGTGAGCGGG + Intergenic
961660086 3:128463837-128463859 GGGGTTCAGGCAGGCTGGGGTGG + Exonic
961824703 3:129592883-129592905 GGGATGCAGGCTGGGGGAGGGGG + Intronic
962292098 3:134145721-134145743 GGGGGCCAGGCAGGGTGAGAGGG + Intronic
962844178 3:139260648-139260670 GGGGGGTAGGCAGGGAGGGAGGG + Intronic
962877931 3:139550144-139550166 GGGGGGCAGGAGGGATGAGATGG + Intergenic
962889514 3:139658918-139658940 GGGGTGCAGGGGGATTGAGAGGG - Intronic
963058373 3:141205804-141205826 GGGGTAGAGACAGGGAGAGAAGG - Intergenic
963170756 3:142248929-142248951 AGGGAGCAGGCAGGGAGTGAGGG + Intergenic
964125711 3:153231596-153231618 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
964545634 3:157830432-157830454 GGGGAGAAGGCCGGGGGAGAAGG - Intergenic
964610752 3:158612443-158612465 GGGGTGGGGGGAGGGGGAGAGGG + Intergenic
964941249 3:162159107-162159129 GGGGTGGAGACATGGAGAGAAGG + Intergenic
965207824 3:165744396-165744418 TAGGTGCAGGCTGGGAGAGAAGG - Intergenic
966826766 3:183971526-183971548 GGGGTGCGGGCAGGGAGGCAGGG + Intronic
966881821 3:184354866-184354888 AAGGTGCAGGCTGGGTGAGCAGG + Intronic
966970970 3:185045093-185045115 GGAGGGCAGGCAGGGAGAAAAGG + Intronic
967080207 3:186042833-186042855 GTAGTCCAGGCGGGGTGAGATGG - Intergenic
967212391 3:187180306-187180328 GGGGTGGAGACAAGGAGAGAAGG + Intronic
967244391 3:187471086-187471108 GGGGTACAGACATGGAGAGAAGG + Intergenic
967834056 3:193945919-193945941 CGGGTGCCTGCAGGGAGAGAAGG + Intergenic
967886033 3:194334001-194334023 GTGGTGGAAGCAGGCTGAGAGGG + Intergenic
968459927 4:719697-719719 GCGGTGCAGGCAGGGTGTTTGGG + Intronic
968512197 4:1000715-1000737 GGGGTGCAGGCGGGCTGGGAGGG - Intronic
968512364 4:1001252-1001274 GGGGTGCGGCCTGGGTGATAGGG - Intronic
968630470 4:1648296-1648318 GCGGTGCAGGCAGGGGTAGGTGG + Intronic
968631577 4:1654762-1654784 CGGGAGCAGGCGGGGTGAGCTGG + Intronic
968651630 4:1762450-1762472 GGGGTGCAGGCAGAGGAAGCAGG - Intergenic
968842391 4:3017030-3017052 AGGGTGCAGGCAGGGGCAGAGGG - Intronic
968954673 4:3712183-3712205 GAGGTGGAGGCAGGGTGGGCTGG - Intergenic
969185507 4:5471358-5471380 GAGGTGCAGGCATGGGGAGAAGG + Intronic
969241291 4:5899960-5899982 GGAGTCCAGGCAGGGTAAGAGGG - Intronic
969422319 4:7104553-7104575 GGGGTGCAGGCAGGGGTGCATGG - Intergenic
969629761 4:8329329-8329351 GGGGTGTAGGGAGGGTGCGATGG + Intergenic
970854269 4:20635050-20635072 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
971425701 4:26512895-26512917 GGGGTGGGAGCAGGATGAGAAGG - Intergenic
971834816 4:31749268-31749290 GGGGAGGAGGGAGGGAGAGAAGG - Intergenic
971946693 4:33287502-33287524 GGCGTCCAGGCAAGGTGAGGAGG - Intergenic
972178942 4:36441319-36441341 GGGGTGCAGTGAGTGTGAAAGGG + Intergenic
972963300 4:44479972-44479994 GGGAAGCAGGCAGGGTCAGTTGG - Intergenic
973345450 4:49049847-49049869 GGGGTGAATGCAGTGTAAGAAGG - Intronic
975108994 4:70602173-70602195 GGATTGTAGGCAGGGTGATATGG - Intronic
975338242 4:73206466-73206488 GGGAGGCAGGCAGGGAGGGAGGG + Intronic
975499310 4:75067654-75067676 GGGGAGAAGGCTGTGTGAGACGG + Intergenic
975882408 4:78926115-78926137 GGGGTGAAGGGAGGTTGGGAAGG - Intronic
975983647 4:80184506-80184528 GGGGTGCAAGCGGGGAGGGAGGG - Intronic
975985399 4:80197555-80197577 GGGGTGGAGGGAGGGAGGGAGGG - Intronic
976002498 4:80388179-80388201 GGGGTGAAGGCTAGGTGAGGTGG + Intronic
976207613 4:82637749-82637771 GGAGTGCAGGCACAGTGTGAGGG + Intronic
976589171 4:86831913-86831935 ACTGTGCAGTCAGGGTGAGAGGG - Intronic
977031649 4:91891669-91891691 ATGGTGCAGGCTGGGGGAGAAGG - Intergenic
977041781 4:92026736-92026758 GGGGTACAGACAAGGAGAGAAGG - Intergenic
977041797 4:92026797-92026819 GGGGTACAGACAAGGAGAGAAGG - Intergenic
977225586 4:94388345-94388367 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
978270155 4:106878968-106878990 GGTGCTCAAGCAGGGTGAGAAGG - Intergenic
978671049 4:111247546-111247568 GTGGTGAAGGTAGGGGGAGATGG - Intergenic
979860494 4:125687191-125687213 GGGGAGCCAGCATGGTGAGAGGG + Intergenic
981300833 4:143184787-143184809 GGGGAGCAGGGAGGGAGAGAGGG + Intergenic
981994659 4:150963154-150963176 GGGGGAGAGGCAGAGTGAGAGGG - Intronic
982234862 4:153242943-153242965 GGGGTGGAGGCAGCATGAGTGGG + Intronic
982394520 4:154901825-154901847 CTGGTGCAGACTGGGTGAGAGGG - Intergenic
984023844 4:174519791-174519813 TGGGTGCAGGCTGGCTGAGTCGG - Intronic
984165544 4:176299484-176299506 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
984860123 4:184230438-184230460 CGGGGGCTGGCAGGGAGAGAGGG - Intergenic
984945131 4:184965115-184965137 GGTGTGCAGCCAGTGTGTGATGG + Intergenic
985269632 4:188181793-188181815 GGGGAGCAGGCAGGGTGTGGTGG + Intergenic
1202771032 4_GL000008v2_random:207766-207788 GGGGAGAAGGCAAGGTGAGGGGG + Intergenic
985546058 5:509743-509765 GGGGTGCGGGGAGGGGGAGGAGG + Intronic
985614383 5:910780-910802 GGGCTGCAGGAAGGGCCAGAGGG - Intronic
985614995 5:914895-914917 GGGGTCCAGGGAGGGTGGAAGGG + Intronic
985652238 5:1112459-1112481 GGGGTGCAGGAAGGGTGGGGGGG - Intergenic
986781626 5:11071691-11071713 GGAGTGCAGACTGGGTAAGAAGG + Intronic
987510205 5:18827590-18827612 GGGGAGCAGACAGTGTGAGGTGG + Intergenic
987874757 5:23667107-23667129 GCTGTGCAGGCAGGGTGGAATGG + Intergenic
988203347 5:28098805-28098827 GGAGGGCATGCATGGTGAGAGGG - Intergenic
988278527 5:29114284-29114306 TAGGTGCAGGTAGGGTGAGGTGG + Intergenic
989494068 5:42090800-42090822 GGGTCTCAGGCTGGGTGAGATGG - Intergenic
989505204 5:42218577-42218599 GGGCGGCAGGCAGGAGGAGATGG + Intergenic
990584764 5:57200222-57200244 TGGATGCAGGCAGGGAGAAACGG + Intronic
990723729 5:58729403-58729425 GGGGTGCAGGGAGAGAGTGATGG - Intronic
990820458 5:59833705-59833727 GTGTTGCAGGCAGTGTGAAAGGG + Intronic
990862727 5:60345297-60345319 GGGGTGGGGGAAGGGGGAGAGGG + Intronic
991587373 5:68215164-68215186 GGGGTGAAGGAGGGGTGAAAGGG - Intergenic
991676600 5:69094448-69094470 GGGAGGCAGGCAGGGGGAGAGGG - Intronic
992357803 5:76003623-76003645 GGGCTTTAGGGAGGGTGAGAAGG + Intergenic
992376227 5:76190368-76190390 TGGGTGCATTCAGGGTGATATGG - Intronic
992452445 5:76886077-76886099 GGGGTGGAGACATGGAGAGAAGG + Intronic
992742750 5:79790554-79790576 GGGATACAGGCCGGGTGAGGTGG - Intronic
993502392 5:88678483-88678505 GGGGTGAGGGCGGGGTGGGAGGG - Intergenic
993647332 5:90476721-90476743 GGGATGCAGGCAGGGGGACCTGG - Intronic
994375974 5:99015940-99015962 GGGGTGGAGACACGGAGAGAAGG + Intergenic
994415719 5:99467899-99467921 GGGGTGGGGGCAGGGGGGGAGGG - Intergenic
994989274 5:106978950-106978972 TGGGTGCAGGCGGGCTGAGTCGG - Intergenic
995125476 5:108573751-108573773 GGGGTACAGACATGGAGAGAAGG + Intergenic
995125855 5:108576502-108576524 GGGGTGCAGTGAGAGTGAAAGGG + Intergenic
995466663 5:112456807-112456829 GGAATGGAGGAAGGGTGAGAGGG + Intergenic
995468942 5:112479866-112479888 AGGATGCAGGCAGGGTGAGGAGG + Intergenic
996009509 5:118465938-118465960 GGGAGGCAGGGAGGGAGAGAGGG + Intergenic
996088743 5:119329979-119330001 GGGAGGAAGGCAGGCTGAGAAGG - Intronic
996726191 5:126675030-126675052 TGGGTGCAGGCGGGCTGAGCCGG + Intergenic
997318035 5:132954408-132954430 GGGGAGCACACAGGGTGAGTGGG + Intronic
997453600 5:134002474-134002496 GGCTTGCAGGGAGGGTGACATGG - Intronic
998378570 5:141708025-141708047 GGGGTGGGGGCAGGGTGAGGTGG + Intergenic
998399061 5:141838537-141838559 TGGGGGCAGGCAGGGTGCGCAGG - Intergenic
998878394 5:146622666-146622688 GGGGTGGTGGAAGGGGGAGAGGG - Intronic
999213770 5:149914274-149914296 GGGAAGGAGGCAGTGTGAGACGG - Intronic
1000302642 5:159970219-159970241 GGGGTGGAGGCAGAGGGAAATGG - Intronic
1000439480 5:161249316-161249338 GGGGTAGAGACAGGGAGAGAAGG - Intergenic
1000618033 5:163451665-163451687 AGGGTCCAGGCAGGATGAGGAGG + Exonic
1001032955 5:168276147-168276169 GGGGTGCAGGGATGGGCAGATGG - Intergenic
1001288102 5:170438216-170438238 GGGGTCCAGGCTGAGGGAGAAGG - Intronic
1001460449 5:171908263-171908285 GGGATCCAGGGAGGGGGAGATGG - Intronic
1001784050 5:174396592-174396614 GGGATGCAGACAGGATGAGGAGG + Intergenic
1001909538 5:175504056-175504078 GGGGTGGGGGAAGGGAGAGAGGG + Intronic
1002134062 5:177097417-177097439 GGGGAGCAGGCAGAGGGAGGTGG - Intronic
1002261493 5:177996476-177996498 TGGGAGCAGGCAGGGGGAGGAGG + Intergenic
1002427856 5:179186395-179186417 GGGGGGCAGGCAGGGTTTGTGGG + Intronic
1002838489 6:885587-885609 GATGTGCAGGCATGGAGAGAGGG - Intergenic
1004329381 6:14707851-14707873 GGGCTGAAGACAAGGTGAGAAGG - Intergenic
1004615314 6:17282558-17282580 TGGGGGGAGGCAGGGTTAGAGGG + Intronic
1004772256 6:18796866-18796888 GGGTTTCAGGCCAGGTGAGATGG - Intergenic
1005002851 6:21260112-21260134 GTGCTGTGGGCAGGGTGAGAGGG + Intergenic
1005015232 6:21369218-21369240 GGAGTTGAGGCAGGCTGAGAAGG - Intergenic
1005822877 6:29612301-29612323 GGTGTGCAGGCTGGGTGTGGTGG - Intronic
1005954792 6:30656350-30656372 TGGGTGGAGGCAGGATGATAGGG - Intronic
1005997871 6:30942504-30942526 GGGGTGGAGGCAGGGGCAGGTGG + Intronic
1006269872 6:32956084-32956106 GTGGTGGAGGCAGGGTGCCAGGG + Intronic
1006297574 6:33176800-33176822 GGGGTGCAGAGAGGGTGACAGGG - Intronic
1006315261 6:33287730-33287752 GAGGGGCAGGCAGGGTGTTAAGG + Intronic
1006375686 6:33670583-33670605 GGGGTGGAGGCAGGGTGGGCGGG + Intronic
1006469962 6:34223228-34223250 GGGGTGGGGGCAGGGTGAAGGGG + Intergenic
1006738676 6:36292575-36292597 GGGGTGCAGGCAGGGTGGGAGGG - Intronic
1006910191 6:37558595-37558617 GGGGAACAGACAGGGTGAGAGGG + Intergenic
1006990686 6:38212383-38212405 GGGGGACAGGAAGGTTGAGAGGG + Intronic
1007521827 6:42455994-42456016 GGGTGGCAGACAGGGTGGGAGGG - Intergenic
1007606079 6:43119152-43119174 TGGGTGCAGGCAGGGTGTAAAGG + Intronic
1007725652 6:43914273-43914295 GGGGTGCAGGTAGGGGTAGAGGG - Intergenic
1007762860 6:44143779-44143801 GGGAAGCAGGCAGGGTAAGAGGG + Intronic
1008029710 6:46680677-46680699 GGGCTGGAGTCAGGTTGAGAGGG - Intergenic
1008078108 6:47167144-47167166 GGGGTGCAAGGATGGGGAGAAGG - Intergenic
1010315776 6:74448459-74448481 GGGCTGGAGGGAGGGGGAGACGG - Intergenic
1011410216 6:87059711-87059733 GAGGGGGAGGCAGGGTGAGAGGG + Intergenic
1011529736 6:88308592-88308614 GGGGTGCAGGCTGGGTGTGGTGG - Intergenic
1012508793 6:99978835-99978857 GTGCTGCAGTCAGTGTGAGATGG + Intronic
1012637942 6:101570480-101570502 AGGGAGCTGGCAGGGGGAGAAGG - Intronic
1012869778 6:104659200-104659222 AAGGTGCAGGCAGGTGGAGAAGG + Intergenic
1012972664 6:105748249-105748271 GGGGGGCAGGGGGAGTGAGAGGG + Intergenic
1013022541 6:106233812-106233834 GGGGTGCAGTGAGAGTGAAAGGG - Intronic
1013298602 6:108781774-108781796 GGGGTGGAAGGAAGGTGAGAAGG + Intergenic
1014602834 6:123436664-123436686 GGAGGGCAGGCTGGGTTAGACGG - Intronic
1015026634 6:128541312-128541334 GGGAGGGAGGCAGGGAGAGAGGG - Intergenic
1015113484 6:129619585-129619607 GGGGAGCAGGGAAGGGGAGAGGG + Intronic
1015269326 6:131323656-131323678 TGGGTGCAGGTAGGCTGAGTCGG - Intergenic
1015277949 6:131403852-131403874 GGGGTGGAGACATGGAGAGAAGG - Intergenic
1016199952 6:141394885-141394907 GGGGTGGAGGCTGAGTGGGAAGG + Intergenic
1016204315 6:141453717-141453739 GGGGTGGAGACATGGAGAGAAGG - Intergenic
1016223829 6:141709108-141709130 AGGGTGGTGGCAGGGCGAGACGG - Intergenic
1016248359 6:142014879-142014901 GGGGAGAAGGAAGGGAGAGAGGG - Intergenic
1016342694 6:143080587-143080609 GGGGTGCAGTGAGAGTGAAAGGG + Intronic
1016576226 6:145572315-145572337 TTGGTGCAGGCTGGGAGAGAAGG + Intronic
1017820679 6:158047002-158047024 GAGGTGAAGGCAGGGCAAGAGGG - Intronic
1018162891 6:161064861-161064883 GAAGTGCAGACAGGGAGAGAGGG + Intronic
1018387867 6:163321487-163321509 GAGGTGCATGCATGCTGAGACGG + Intergenic
1018816426 6:167336040-167336062 GGGGTCCATTCAGGGAGAGATGG - Intronic
1018936979 6:168279962-168279984 GGGGCTCAGGCAGGGTCAGAGGG + Intergenic
1018974608 6:168555516-168555538 AGGGTGCTGGCAGAGGGAGAAGG - Intronic
1019039549 6:169092228-169092250 AGGATGCAGGGAAGGTGAGAGGG + Intergenic
1019378975 7:711746-711768 GGGGCTCAGGCAGGGGGGGAGGG + Intronic
1019402952 7:866728-866750 GGGGTGAAGGCCCGGTGGGACGG - Intronic
1019558148 7:1642685-1642707 GGGAGGCAGGCAGGGAGGGAGGG - Intergenic
1019712299 7:2523301-2523323 GGGGTGCATGCATGGAGAGGCGG + Intronic
1019996015 7:4725008-4725030 GGGCAGCAGGCAGGGTTAGGAGG - Intronic
1020989937 7:15184293-15184315 GGGAGGCAGGCAGGGAGGGAGGG + Intergenic
1021253610 7:18361926-18361948 GGGGAGCTGGCAAGGAGAGAAGG - Intronic
1021338191 7:19430066-19430088 GGGGTACAGGCCGGGTGAGGTGG - Intergenic
1021563049 7:21987878-21987900 GAGGTGCAGGCCAGGTGCGATGG + Intergenic
1021579081 7:22133238-22133260 AGGGTGCTGGCCAGGTGAGAGGG + Intronic
1021697074 7:23286227-23286249 GGGGGGAAGGAAGGGAGAGAGGG - Intergenic
1021971104 7:25966781-25966803 GGGATGGAGGTAGGTTGAGAAGG + Intergenic
1021994656 7:26168078-26168100 GGGAGGCAGGAAGGGAGAGAGGG - Intronic
1022425661 7:30266562-30266584 TGTGTGCAGGCAGGCTGTGAAGG - Intergenic
1022523974 7:31025637-31025659 GAGCTGCAGGCAGGGTGGAAAGG + Intergenic
1022811639 7:33874401-33874423 GGGGTGGAGGAAGGGAGAGAGGG - Intergenic
1022843039 7:34182784-34182806 GGGGGGTAGGAAGGGTGGGAAGG - Intergenic
1022941852 7:35249364-35249386 GGGCTGCAGGGAGGTTGGGATGG - Intronic
1023295871 7:38714728-38714750 AGGGAGCAGGCAGGGAAAGAGGG - Intergenic
1023403914 7:39811806-39811828 GTGGGGCAGGGAGGGAGAGAAGG + Intergenic
1023722660 7:43112579-43112601 GAGGAGCAGGCAGGGAGGGAGGG + Exonic
1023810380 7:43906689-43906711 GGGGTGGAGGTGGGGTGAGGTGG + Exonic
1023958092 7:44903778-44903800 CAGGTACAGGCAGGGTGAGGTGG - Intergenic
1024083212 7:45872976-45872998 GGGGTGCAGGTAGGTGGGGAGGG - Intergenic
1024284688 7:47746996-47747018 GGTGTGCAGGCAGGGAAAGAAGG - Intronic
1024507911 7:50178540-50178562 AGAGAGCAGGCAGGGAGAGAAGG + Intergenic
1024670016 7:51585737-51585759 GGGTTCAAGGCTGGGTGAGAGGG + Intergenic
1024678859 7:51662343-51662365 AGGTTGCAGGCAGGGTGATGGGG + Intergenic
1025002038 7:55324430-55324452 AGGGTGCGGGTGGGGTGAGAAGG - Intergenic
1025072101 7:55908919-55908941 GGGGTCCAGGCCGGGTGCGGTGG + Intronic
1025236341 7:57237282-57237304 GGGGAGCTGGCGGGGTGGGAGGG - Intergenic
1026360978 7:69600194-69600216 GGGGTGCAGGGAGGGGGCGCAGG - Intronic
1026606204 7:71818188-71818210 GGGGTGAAGGGTGGGTCAGAGGG + Intronic
1026859979 7:73779800-73779822 GGGAGGCAGGCAGGGAGGGAGGG - Intergenic
1026963011 7:74421403-74421425 GGGGGTCAGGCAGGGCGTGATGG - Intergenic
1026969853 7:74461175-74461197 GTGGTGGAGACAGGGTGGGAGGG + Intronic
1027235456 7:76295096-76295118 GGGGTTGGGGGAGGGTGAGAGGG - Intergenic
1028284438 7:88978786-88978808 GGGAGGCAGGGAGGGAGAGAGGG - Intronic
1029300581 7:99579904-99579926 GGGGTGCACACAGGGAGAGGAGG + Intronic
1029452174 7:100647342-100647364 GGGGAGCAGGGAGGGGGAGCGGG - Intronic
1029804394 7:102981377-102981399 GGTGTGCAGGCAATGGGAGATGG - Intronic
1031929845 7:127674030-127674052 GGGAGGCAGGCAGGGAGGGAGGG - Intronic
1032073834 7:128826771-128826793 GGGTTGCAGGGAAGGGGAGAGGG + Intergenic
1034101280 7:148452555-148452577 TGGGAGGAGGCAGGCTGAGATGG + Intergenic
1034902600 7:154916561-154916583 GGGGGGCAGGCAGGGGCAGGCGG + Intergenic
1035097409 7:156366554-156366576 GACTCGCAGGCAGGGTGAGAAGG + Intergenic
1035174593 7:157041114-157041136 GGGGTGCCGGCATGGTTAGAAGG + Intergenic
1035275452 7:157745484-157745506 GGGAGGCAGGCTGGGGGAGAGGG + Intronic
1035389871 7:158497048-158497070 GGGGTGCAGGGAAGGGGAGGGGG - Intronic
1035688956 8:1547403-1547425 TGGGTGGAGGCAGGGGGAGAGGG + Intronic
1036442969 8:8797570-8797592 GGGATGGGGGCAGGGGGAGAAGG + Intronic
1036472581 8:9064277-9064299 GGGGTGGAGACATGGAGAGAAGG + Intronic
1036918845 8:12832456-12832478 TGAGAGCAGGCAGGGAGAGAGGG - Intergenic
1037364555 8:18107988-18108010 TCGGTGCAGGCTGGGGGAGAGGG + Intergenic
1037459883 8:19098201-19098223 AGAGTGCAGGCTGGGTGTGATGG - Intergenic
1037567247 8:20128114-20128136 GGGATGGAGGGAGGGAGAGAGGG + Intergenic
1037605520 8:20434622-20434644 GGCTTGAAGGCAGGGTGGGAGGG + Intergenic
1037685854 8:21138857-21138879 AGAGGGCAAGCAGGGTGAGAGGG + Intergenic
1037776510 8:21839058-21839080 GGGATGGAGGCGGGGAGAGATGG + Intergenic
1037903311 8:22700937-22700959 GGGGTTCAGGGAGGGTAAGTGGG + Intergenic
1037962805 8:23111638-23111660 GGGGTGAAGGGAATGTGAGATGG + Intronic
1037968664 8:23155039-23155061 GGGGTGAAGGGAATGTGAGACGG - Intronic
1037989041 8:23307472-23307494 GGGGAGCAGGCAGGGAGCCAGGG + Intronic
1038178979 8:25208868-25208890 GGAGTGCAGGGAGGGAGGGAAGG - Intronic
1038392307 8:27213713-27213735 GGGAGGGAGGCAGGGAGAGAGGG + Intergenic
1039085137 8:33772253-33772275 TGTGTGAAGGCAAGGTGAGAGGG + Intergenic
1039425114 8:37479185-37479207 TGGGTGTAGACAGTGTGAGAAGG + Intergenic
1039459137 8:37728826-37728848 GGGGAGTAGGGAGGGAGAGAAGG - Intergenic
1040053792 8:43040618-43040640 GGGAGGCAGGCAGGGAGGGAGGG - Intronic
1040413486 8:47178374-47178396 GGGGTGGAGAGAGGTTGAGAGGG - Intergenic
1040491321 8:47924976-47924998 GGGGTGCAGGCAGGGTGAGAAGG - Intronic
1040882153 8:52217538-52217560 GGGGTGAATGCAAGGTGAAATGG + Intronic
1041102958 8:54415126-54415148 GGGAACCAGGCAGTGTGAGACGG - Intergenic
1041138116 8:54782665-54782687 GGTGTGGACTCAGGGTGAGAGGG + Intergenic
1041301978 8:56421089-56421111 GGGGTGGAGGGAGGGGGGGAGGG + Intergenic
1042705819 8:71664937-71664959 TGGGTGCAGGCAGGCTGAGTTGG - Intergenic
1042944951 8:74145208-74145230 GGGAAGCCGGCAGGGAGAGATGG + Intergenic
1043777127 8:84283766-84283788 GAGGGGCAGTCAGGGTGGGAAGG + Intronic
1044037137 8:87320864-87320886 GGGCTGCAGGGAAGGTGAAATGG - Intronic
1044148712 8:88746906-88746928 GGGGTACAGACATGGAGAGAAGG + Intergenic
1044822181 8:96161778-96161800 GGTGGGAAGGCAGTGTGAGATGG - Intergenic
1045309039 8:100984624-100984646 GGGTTCCAGGCCGGGTGAGGTGG - Intergenic
1045326198 8:101119448-101119470 GGGGGGCAGCCAGGGTGTGTTGG + Intergenic
1045479576 8:102581414-102581436 GGGGTGTGGGATGGGTGAGATGG - Intergenic
1046639717 8:116714958-116714980 GGGCTGCAGGAAAGCTGAGAAGG + Intronic
1047725929 8:127683972-127683994 GGAGTGCAGGCAGGGATAGAGGG - Intergenic
1048499259 8:134960859-134960881 GGCATGGAGGGAGGGTGAGATGG + Intergenic
1048924156 8:139255877-139255899 GGGGTGCAGGGCGGGTGAAAGGG - Intergenic
1049006763 8:139860641-139860663 GGGGTGCAGGAGGGATGAGCTGG - Intronic
1049094555 8:140540729-140540751 GGTGTGGAGGCAGGGCCAGAAGG - Intronic
1049385530 8:142341248-142341270 TGGGTGCAGGGAGGCTGGGAAGG - Intronic
1049405468 8:142450146-142450168 GGGGCGCAGCGAGGGTGGGAGGG + Intronic
1049804538 8:144532937-144532959 GGTGTGCAGGCCAGGAGAGAGGG - Intronic
1050296600 9:4211421-4211443 TGCGTGCAGGATGGGTGAGATGG - Intronic
1050610265 9:7344817-7344839 GGGGTGCAGCCAGGGAGGGGTGG + Intergenic
1051170276 9:14314175-14314197 GGGGTGGGGGCGGGGTGGGATGG + Intronic
1051233875 9:14978612-14978634 GGGGTGCACACAGGGAGAGGAGG - Intergenic
1051526863 9:18055033-18055055 GAGCTGCAGGCAGGGTGAGATGG - Intergenic
1052246228 9:26338657-26338679 GGGCTGCAGGGAGGGAGAAATGG - Intergenic
1053078717 9:35156304-35156326 TGGGTGCAGGCGGGGTGAGTCGG + Intergenic
1054355000 9:64051908-64051930 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1054355012 9:64051935-64051957 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1054452529 9:65410908-65410930 GGGCTGAAGGCAGTGTGAAAGGG - Intergenic
1054947822 9:70814851-70814873 GGGAAGCAGGAAGGGAGAGAGGG - Intronic
1055445169 9:76375287-76375309 GGAGGTCAGGCAGGGTGAGTAGG - Intergenic
1055733181 9:79300096-79300118 ATGGTGCAGGCAGGGTGGGGTGG - Intergenic
1055882281 9:81015191-81015213 TGGGTGTAGGCAGGCTGAGTCGG - Intergenic
1056064894 9:82923812-82923834 GAGCTGCAGGAAGGGGGAGAGGG + Intergenic
1056258600 9:84825261-84825283 GGGGTGGAAGCATGGTGAGAAGG - Intronic
1056559573 9:87718410-87718432 GGCTTGCATGGAGGGTGAGAAGG - Intergenic
1056975996 9:91254369-91254391 GGGGTGCAGACAGGATGGGAAGG + Intronic
1057521835 9:95766396-95766418 GGGCTGAGGACAGGGTGAGAAGG + Intergenic
1057693993 9:97310859-97310881 GGGCATCAGGCAGGGTGATATGG - Intronic
1057800278 9:98186836-98186858 GGGGTCCAGGCCAGGTGAGCAGG - Intronic
1057930056 9:99185332-99185354 GAGGCGCTGGCAGGGAGAGAGGG + Intergenic
1057983820 9:99689205-99689227 GGGGTGCATGCAGTGTGAGTGGG - Intergenic
1058680337 9:107435153-107435175 GAAGTGCAGGCAGGGTGCGGTGG - Intergenic
1058820153 9:108722218-108722240 GGGGTGGGGGAAGGGGGAGATGG + Intergenic
1059451831 9:114376042-114376064 GGGGTGGAGGCTGGCTGAGGTGG - Intronic
1059684900 9:116625674-116625696 GGGGTGCAGGGGGGTTGAGATGG - Intronic
1060023606 9:120152479-120152501 GTGCTGCAGGCAGGGGGAGTGGG + Intergenic
1060591088 9:124817395-124817417 GGGGTGTGTGCAGGGTGAGAAGG - Intergenic
1060943353 9:127556021-127556043 GGGGTGCGGGTAGGGTGGGGTGG - Intronic
1061036806 9:128118761-128118783 GGGGTGCAGGGATGCAGAGATGG + Intergenic
1061036821 9:128118808-128118830 GGGGTGCAGGGATGGAGGGATGG + Intergenic
1061036916 9:128119082-128119104 GGGGTGCAGGGATGGAGGGATGG + Intergenic
1061218353 9:129234999-129235021 GGGGTGGGGGCAGGGTGGGCAGG - Intergenic
1061290908 9:129649812-129649834 GGGTGCCAGCCAGGGTGAGATGG - Intergenic
1061314776 9:129788134-129788156 GGGATGCAAGTACGGTGAGACGG - Intergenic
1061399822 9:130362186-130362208 GAGGTGCAGGGAGGTTGAGCCGG - Intronic
1061411279 9:130423117-130423139 GGGGTGCAGGCTGGAGGTGACGG + Intronic
1061610248 9:131740887-131740909 GGGGTGCGGGCAGGGTGCAGTGG - Intergenic
1061724082 9:132572004-132572026 GGAGTGCAGACAGGGTCAGGAGG + Intronic
1061750382 9:132772953-132772975 GGGCTGTAGGCAGGGGGACAAGG - Intronic
1061763029 9:132863509-132863531 GAGATACAGGCAGGGTGTGAAGG - Intronic
1062054676 9:134464604-134464626 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054692 9:134464661-134464683 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054709 9:134464718-134464740 GGGGGGGAGGCTGGGTGAGCCGG - Intergenic
1062054738 9:134464832-134464854 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054783 9:134465003-134465025 GGGGGGGAGGCTGGGTGAGCCGG - Intergenic
1062054798 9:134465060-134465082 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054830 9:134465174-134465196 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054846 9:134465231-134465253 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054878 9:134465345-134465367 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054894 9:134465402-134465424 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054926 9:134465516-134465538 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054958 9:134465630-134465652 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062054974 9:134465687-134465709 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062055021 9:134465858-134465880 GGGGGGGAGGCTGGGTGAGCCGG - Intergenic
1062055065 9:134466029-134466051 GGGGGGGAGGCTGGGTGAGCCGG - Intergenic
1062055080 9:134466086-134466108 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062055113 9:134466200-134466222 GGGGGGGAGGCTGGGTGAGCCGG - Intergenic
1062055128 9:134466257-134466279 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062055160 9:134466371-134466393 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062055176 9:134466428-134466450 GGGGGGGAGGCTGGGTGAGCGGG - Intergenic
1062080832 9:134622566-134622588 GGGAGGAAGGCAGGGAGAGAAGG - Intergenic
1062080862 9:134622665-134622687 GGGAGGAAGGCAGGGAGAGAGGG - Intergenic
1062080893 9:134622766-134622788 GGGAGGAAGGCAGGGAGAGAGGG - Intergenic
1062119338 9:134825749-134825771 GGGAGGCAGGCAGAGTCAGAAGG - Intronic
1062170817 9:135133702-135133724 AGGGTGCAGGGAGGGTGACTGGG + Intergenic
1062202273 9:135309849-135309871 GGAGGGCAGGGAGGGTGTGATGG + Intergenic
1062722891 9:138053657-138053679 GGGGTGGAGCCATGGTGGGAGGG - Intronic
1062722912 9:138053716-138053738 GGGGTGAAGCCAAGGTGGGAGGG - Intronic
1203743344 Un_GL000218v1:21040-21062 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1203470181 Un_GL000220v1:112679-112701 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1203478002 Un_GL000220v1:156651-156673 AGGGTGCCGGCGGGGAGAGAGGG + Intergenic
1203703622 Un_KI270742v1:16008-16030 GGGGAGGAGGCAAGGTGAGGGGG - Intergenic
1185857219 X:3546965-3546987 GGGATGCAGGGAGGGAGGGAAGG + Intergenic
1186116314 X:6308273-6308295 TGGGTGCAGGCGGGCTGAGTCGG - Intergenic
1186162619 X:6793626-6793648 GGGATGCAGGCAAAGTGACAAGG - Intergenic
1186246668 X:7622642-7622664 GGGAGGCAGGAAGGGAGAGAAGG - Intergenic
1186254117 X:7701111-7701133 GGGGTGCAGTGAGAGTGAAAGGG + Intergenic
1186343885 X:8670968-8670990 GCAGTGAAGGCAGGGTGAGGCGG - Intronic
1186749336 X:12605618-12605640 GGGTTGCAGGCAGGGTGGTGAGG - Intronic
1187523937 X:20037374-20037396 GGAGAGAAGGCAGGGTGACAGGG - Intronic
1187677192 X:21727958-21727980 GGGCTGCACACAGCGTGAGAGGG + Intronic
1187717069 X:22113407-22113429 GGGGTGCAGGCAGGGAGGAAGGG - Intronic
1187883280 X:23865537-23865559 GGGTTGCAGTGAGGCTGAGATGG + Intronic
1188405649 X:29805995-29806017 GGGATGGAGGCAGGGAGGGAGGG + Intronic
1189213902 X:39306982-39307004 AGGGAGGAGGCAGGTTGAGAAGG + Intergenic
1189244250 X:39551023-39551045 AGGGTGCAGGCAGTGGGAGGAGG - Intergenic
1190501807 X:51086482-51086504 GGGCTGAAAGCAGGGTGGGAGGG + Intergenic
1190985037 X:55492286-55492308 GGGCTGCAGGGAGGGTGCCATGG + Intergenic
1192208489 X:69111429-69111451 GTGGGGCAGGCATAGTGAGAAGG + Intergenic
1193046061 X:77055717-77055739 AGGGTGCAGGGTGGGTGACATGG + Intergenic
1193808273 X:86019092-86019114 GGGGTGCAGGCAGGAAGAGGAGG + Intronic
1193922172 X:87443265-87443287 GGGGTGGAGGGAGGGGGGGAGGG - Intergenic
1194293915 X:92105505-92105527 TGGGTGCAGGCGGGCTGAGTCGG + Intronic
1194815296 X:98433382-98433404 GGGGTACAGGCAGGGAAACATGG - Intergenic
1194874036 X:99164269-99164291 GGGGTAGAGACAGGGAGAGAAGG + Intergenic
1195283060 X:103356375-103356397 GGGGGGCGGGGAGGGAGAGAGGG + Intergenic
1196542917 X:116930612-116930634 GGGGGGCGGGAAGGGAGAGAGGG + Intergenic
1197470737 X:126864006-126864028 GGGGTAGAGACAGGGAGAGAAGG - Intergenic
1197709439 X:129655041-129655063 GGGGGGCAGGAAGAGGGAGAGGG + Intergenic
1198031152 X:132754701-132754723 AGGGTGCAGGCCGGGTGTGGTGG - Intronic
1198231059 X:134690020-134690042 GGGCTGCAGGGAGGGAGAAATGG - Intronic
1198723530 X:139651385-139651407 TGGTTGCAGGCTGGGTGGGAGGG - Intronic
1199194810 X:145015916-145015938 GGGGAGCGGGCAGGGTGGGGTGG + Intergenic
1199680043 X:150217893-150217915 GGGGTGGGGGGAGGGTGGGAGGG + Intergenic
1199700264 X:150370672-150370694 GGGGTGGAGGCAGGGAAATAAGG - Intronic
1199741490 X:150740261-150740283 GGGGGGCGGGCATTGTGAGAAGG - Intronic
1200119892 X:153785202-153785224 TGGCTGCAGGGAGGGTGGGACGG + Intronic
1200379752 X:155822323-155822345 GGGATGGAGGGAGGGGGAGAGGG + Intergenic
1201156873 Y:11138511-11138533 GGGGAGGAGGCAAGGTGAGGAGG - Intergenic
1201473666 Y:14359022-14359044 GGGGTGGAGACAGGGAGAGAAGG + Intergenic
1201557082 Y:15274134-15274156 GGGATGCAGGCAAAGTGACAAGG - Intergenic
1202076868 Y:21044813-21044835 TGGGTGCAGGCAGGCTGAGTAGG + Intergenic