ID: 1040491322

View in Genome Browser
Species Human (GRCh38)
Location 8:47924984-47925006
Sequence GGGATGTTGGGGTGCAGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 567
Summary {0: 1, 1: 0, 2: 4, 3: 60, 4: 502}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491322_1040491335 17 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491335 8:47925024-47925046 CGTGGGTGCCTCATCTGGCTTGG No data
1040491322_1040491330 -1 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491322_1040491334 12 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data
1040491322_1040491336 18 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491336 8:47925025-47925047 GTGGGTGCCTCATCTGGCTTGGG No data
1040491322_1040491331 0 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491322 Original CRISPR GGGATGTTGGGGTGCAGGCA GGG (reversed) Intronic
900014164 1:137361-137383 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
900044027 1:492563-492585 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
900065437 1:727469-727491 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
900566122 1:3332750-3332772 GTGCTGCTGGGGTGCAGTCAGGG - Intronic
900993063 1:6106797-6106819 GGGATGGTAGGATGCAGGGATGG + Intronic
900993070 1:6106813-6106835 GGGATGGAGGGGTGGAGGGATGG + Intronic
900993575 1:6108747-6108769 GGGATGGAGGGTTGGAGGCATGG + Intronic
901059029 1:6463152-6463174 GGGATGAGGGGGTGCATGCCAGG + Intronic
902336743 1:15758628-15758650 GGCAGGTTGGGGGGCAGGTAGGG + Intronic
902687530 1:18088354-18088376 GGACTGTTTGGCTGCAGGCAGGG + Intergenic
903657010 1:24955672-24955694 TGGCTGTCGGGGTTCAGGCAAGG + Intronic
904113437 1:28144422-28144444 GGGATGGTGGGATGGAGGGATGG + Intergenic
905768617 1:40623440-40623462 GTGATGTTGGGTTGTGGGCAGGG - Exonic
905804429 1:40865513-40865535 AGGAGGTTGGGGTGCAGGGGAGG + Intergenic
906225006 1:44114448-44114470 GGGACGTCGGGGTGCAGCAAAGG + Intergenic
906896497 1:49778812-49778834 GGGAAGTTGGGAGGGAGGCAAGG + Intronic
907192391 1:52660311-52660333 GAGCTGTTGGGGGGCAGGGAGGG - Intronic
907402070 1:54230356-54230378 GGGATTTTGGGGGTCTGGCATGG - Intronic
907513449 1:54979185-54979207 CTGATGTTGGGGTCCAGGCCTGG - Intergenic
910268868 1:85370702-85370724 TGGATGTGGGGGTGAAGGAAAGG + Intronic
912204442 1:107494598-107494620 GGGAAGTTGGAGAGCAGGTAGGG - Intergenic
912727909 1:112075813-112075835 GGGATGTGTGGGTGAAGGGACGG + Intergenic
912901415 1:113653914-113653936 GGGCTCCTGGGGTGCAGGCCTGG - Exonic
913328840 1:117650832-117650854 GGGATGGGGGGTTGGAGGCAGGG - Intergenic
914884661 1:151575030-151575052 GTGAAGTTGGGTTGCAGGGAGGG + Intronic
915593223 1:156882263-156882285 GGGGTGATGGGGGGCAGGAAAGG + Intergenic
916679169 1:167088785-167088807 GGGTTGGGGTGGTGCAGGCATGG + Intronic
917959332 1:180129774-180129796 AGGAAGGTGGGGTGCAGGCTGGG + Intergenic
919357143 1:196537962-196537984 GGGACCTTCAGGTGCAGGCAGGG - Intronic
920141937 1:203822398-203822420 AGGATGTTGGGGTCCAAGCAGGG - Intronic
920326502 1:205169127-205169149 AGCTTGTTGGGGTGCTGGCACGG - Intronic
920792211 1:209104065-209104087 GGCATGTTGGGGTGCAAATAGGG - Intergenic
921717550 1:218433690-218433712 GGGGAGTTGGGGTACAGGAAGGG - Intronic
921925399 1:220706651-220706673 GGGAGGCTGGGGTGAAGGCCGGG - Intergenic
922734495 1:227971966-227971988 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
922734714 1:227972853-227972875 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
922734776 1:227973097-227973119 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
924063523 1:240200678-240200700 GGGATTTTAGGGTGCAGGTAAGG + Intronic
924343491 1:243054936-243054958 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1063157237 10:3391010-3391032 GGGATGTGGGGATGGAGGAATGG + Intergenic
1063980783 10:11450065-11450087 GGGCTGTCTGGCTGCAGGCAGGG + Intergenic
1064634606 10:17351094-17351116 GAGATGCTGGGGTGGGGGCAGGG - Intronic
1064988986 10:21239435-21239457 GGGATGTGGGGGTGCAGAGTGGG - Intergenic
1065807041 10:29403676-29403698 GGAATGTTGTGGTGCAATCATGG + Intergenic
1065818099 10:29500292-29500314 GGGGTCTTGCGGTGCAGGGAGGG - Intronic
1065954821 10:30684213-30684235 GGGGTCTTGTGGTGCAGGGAGGG + Intergenic
1066732625 10:38449168-38449190 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1066733033 10:38450776-38450798 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1067459532 10:46447472-46447494 TGGGTGGTGGGGGGCAGGCATGG + Intergenic
1067627658 10:47937141-47937163 TGGGTGGTGGGGGGCAGGCATGG - Intergenic
1067649572 10:48142978-48143000 GGGATGTGGTGCAGCAGGCAGGG - Intergenic
1067807694 10:49404515-49404537 GGGAGGTTGGGGTGTTGGGAGGG + Intergenic
1067940737 10:50653442-50653464 GGGATGTTAGGGTCCAGAAAAGG - Intergenic
1068008585 10:51420030-51420052 GGGATGTTGGGGGGCAGGTCTGG + Intronic
1068569742 10:58616071-58616093 GGGACCTTCAGGTGCAGGCAGGG + Intronic
1069034165 10:63630353-63630375 GGGAGGTTGCGGTGCAGGGTGGG + Intergenic
1069558510 10:69413529-69413551 GAGAGGGTGGGGTGCAGGGAGGG + Intronic
1069785036 10:70982307-70982329 GGGAGGTTGGGGAGCAGGATAGG - Intergenic
1069838123 10:71322128-71322150 GGGATGGTGGGGGGCGGGGAGGG - Intronic
1069854734 10:71433827-71433849 GGGATGATGAGCTCCAGGCAGGG - Intronic
1070799535 10:79237087-79237109 GGGATGTGGGGATGGAGCCAGGG + Intronic
1071444774 10:85735811-85735833 GGGATGGAGGGATGCAGGGAAGG + Intronic
1072478089 10:95782861-95782883 GGGATAATGGGATGGAGGCATGG + Intronic
1073045963 10:100638288-100638310 GTGCTGTTGGGGTGCACGCGTGG - Intergenic
1073447341 10:103589560-103589582 GCGAGGTTGGCGTGGAGGCAGGG - Exonic
1073468404 10:103707994-103708016 GGGCTGTGGGTGTGCAGGGAAGG - Intronic
1073483048 10:103798913-103798935 GGGATGTTGGGCTGCATGGCTGG - Intronic
1075462513 10:122626965-122626987 AGGAGGGTGGGGTGCGGGCAAGG + Intronic
1075713222 10:124541847-124541869 GGGAAGTAGGGGTGAAGGAAAGG - Intronic
1076019254 10:127056972-127056994 GGGATGATGGGGAGCAGGGGTGG - Intronic
1076345406 10:129775668-129775690 AGGATGTTGTGGTTCAGGCCTGG + Intergenic
1076401190 10:130186544-130186566 GGGGTGGTGGGGTGCGGGCAAGG + Intergenic
1076785084 10:132745667-132745689 GGCATGGTGGGCTTCAGGCATGG + Intronic
1076970364 11:129038-129060 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1077251553 11:1563069-1563091 GGGACTGTGGGGTGCAGGCACGG - Intronic
1077283157 11:1754493-1754515 GGGATGTGGGGATGGAGGGATGG + Intronic
1078067961 11:8090237-8090259 GGGATGTGGGGCAGCAGGCAAGG - Intronic
1078426613 11:11256207-11256229 GGGCAGTGGGGGTACAGGCAAGG - Intergenic
1078426715 11:11257475-11257497 GGGCAGTGGGGGTACAGGCAAGG - Intergenic
1078930010 11:15905602-15905624 GGCAGGTTGGGCTGCAGGCCCGG - Intergenic
1080268793 11:30428381-30428403 AGGATTTTGGGGGCCAGGCATGG + Intronic
1081565833 11:44260552-44260574 GAGATGTAGGGGCCCAGGCATGG - Exonic
1081693940 11:45096490-45096512 GGGTTGTGGGGGTGCAGGCAGGG + Intronic
1082795658 11:57376441-57376463 GGGATGGTGTGGTGCAGGTGAGG - Intergenic
1083196289 11:61090608-61090630 GGGATGTTGGGAGGCTGGCCGGG - Intergenic
1083254355 11:61487077-61487099 GGGATTTGGGGGTGGAGGCTAGG - Intronic
1083276667 11:61600740-61600762 GGGATGTGGGGGTCCAAGCTGGG + Intergenic
1083425005 11:62578940-62578962 GGGAAGCTGGGGTGCAGGCCAGG + Exonic
1083535523 11:63463652-63463674 GGTATGGTGGGGTGGAGGTAGGG - Intronic
1083577255 11:63801103-63801125 GGGATGTTGGGAAGGAGGGAAGG + Intergenic
1083719462 11:64597287-64597309 GGGAGCTGGGGCTGCAGGCAGGG - Intronic
1085415781 11:76318349-76318371 GGGATGATGGGGGGCAGGGAAGG + Intergenic
1085515208 11:77107625-77107647 GGGATGCTGTGGTGCACCCATGG + Intronic
1087705094 11:101481237-101481259 GGGATGTTGGGGGGAGGGAATGG + Intronic
1089128486 11:116193821-116193843 GGGAGGAGGGAGTGCAGGCAGGG - Intergenic
1089517339 11:119041639-119041661 GGGGAGGTGGGGGGCAGGCACGG - Intergenic
1089623094 11:119733950-119733972 GGGATGTTGGTGACTAGGCAGGG + Intergenic
1091087785 11:132739638-132739660 TGTATGTTGGGGTGGAGGCAAGG + Intronic
1091170802 11:133518245-133518267 GGGTGGGTGGTGTGCAGGCATGG + Intronic
1091170813 11:133518355-133518377 GGGTGGGTGGTGTGCAGGCATGG + Intronic
1091899980 12:4136760-4136782 GGGATGTTGGGGGGAAGGGAAGG - Intergenic
1092254649 12:6919785-6919807 GGGAGGTCTGGGGGCAGGCAGGG + Intronic
1092519484 12:9253167-9253189 GGCCTGTTGGGGTGGGGGCAGGG + Intergenic
1092527641 12:9318878-9318900 TGCATGTTGGGGTGCAGGACAGG + Intergenic
1092539617 12:9412878-9412900 TGCATGTTGGGGTGCAGGACAGG - Intergenic
1093971185 12:25377441-25377463 GGGGTGAGGGGGTGCAGGGAAGG - Intergenic
1094783293 12:33818029-33818051 GTGGTGGTGGGGTGCTGGCAAGG + Intergenic
1094877364 12:34665857-34665879 GGGATGTTTGGGAGCACACAAGG + Intergenic
1095097887 12:38157778-38157800 GGGATGCTGGGGTCCTGCCACGG + Intergenic
1095138693 12:38637372-38637394 GAGAGGTAGGGGTGCACGCATGG - Intergenic
1096780634 12:53990038-53990060 GGGATGTGGGGGTGCTAGGAGGG - Exonic
1098107446 12:67084289-67084311 GGGGTGTTGTGTTGCAGGAAAGG - Intergenic
1099184282 12:79500547-79500569 GTGATGTTAGGGGCCAGGCACGG - Intergenic
1100025489 12:90122597-90122619 GGGATGTTGGGCTCCAGGGCAGG + Intergenic
1100340651 12:93676665-93676687 AGGAGGTTGGGGACCAGGCATGG + Intergenic
1100611134 12:96193300-96193322 GTGAGGTTGGGGCGCAGGCCTGG + Intergenic
1100616455 12:96235184-96235206 CGGCTGTGGGGGTGCAGGGAAGG - Intronic
1101040153 12:100747378-100747400 GGGGTGTAGGGAAGCAGGCAGGG - Intronic
1101739006 12:107485332-107485354 GGGGTCCTGAGGTGCAGGCAGGG - Intronic
1103702449 12:122855017-122855039 GGGAAGTTCGGGTTCAGGAAGGG - Intronic
1103716531 12:122948567-122948589 GGGATGTTTGGGGGCTGCCAGGG + Intronic
1103941957 12:124506073-124506095 GGGGTGAAGGGGTGCAGGAATGG - Intronic
1104006774 12:124898545-124898567 GAGATGGAGGGGTGCAGGGACGG + Intergenic
1104107451 12:125676674-125676696 TTGATGTTGGGGTGGGGGCAGGG + Intergenic
1104642521 12:130476524-130476546 GGGTAGCTGGGGTGCAGCCAGGG - Intronic
1104850680 12:131872057-131872079 TGGATGTTGGGGAGGAGGGAGGG + Intergenic
1104857878 12:131910339-131910361 GGGAGGAAGGGGTGCATGCAGGG - Intronic
1104953567 12:132453301-132453323 GGCATATTGGGGTGCAGGGAGGG - Intergenic
1104988429 12:132610746-132610768 GGGATGCTGTGGGGAAGGCAGGG - Intergenic
1108420606 13:50245244-50245266 GGGATCTTGGGTTGCAGGCTTGG + Intronic
1109241600 13:59896584-59896606 GGGAGGCGGGGGTGGAGGCAGGG + Intronic
1113676268 13:112209802-112209824 GTGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676332 13:112209988-112210010 GGGCAGGCGGGGTGCAGGCAGGG + Intergenic
1113676348 13:112210032-112210054 GGGCAGGTGGGGTGCAGGCATGG + Intergenic
1113676357 13:112210054-112210076 GGGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676366 13:112210076-112210098 GGGCAGGCGGGGTGCAGGCAGGG + Intergenic
1113676375 13:112210098-112210120 GGGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676384 13:112210120-112210142 GGGCAGGCGGGGTGCAGGCAGGG + Intergenic
1113676393 13:112210142-112210164 GGGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676402 13:112210164-112210186 GGGCAGGCGGGGTGCAGGCAGGG + Intergenic
1113676410 13:112210186-112210208 GGGCAGGTGGGGTGCAGGCATGG + Intergenic
1113676424 13:112210230-112210252 AGGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676433 13:112210252-112210274 GGGCAGGTGGGGTGCAGGCAGGG + Intergenic
1113676440 13:112210274-112210296 GGGTGGTTAGGGTGCAGTCAGGG + Intergenic
1113676450 13:112210306-112210328 GAGCAGTTGGGGTGCAGTCAGGG + Intergenic
1113847894 13:113402932-113402954 GGCATGGTGGGGTGTGGGCAGGG + Intergenic
1117752748 14:58940116-58940138 GGGATGGGGTGGTGAAGGCAAGG + Intergenic
1120885451 14:89448442-89448464 AGGATGGTGTGGTGCAGGGAGGG - Intronic
1121320123 14:92987291-92987313 TGGCTGTGGGGGTGCAGGAAAGG + Intronic
1122061243 14:99138097-99138119 GGGATGTTAAGGAGAAGGCAGGG - Intergenic
1122128840 14:99593508-99593530 GGGAGGTAGGGGTGCAAGCCAGG + Intronic
1122596878 14:102899761-102899783 TGGCAGTGGGGGTGCAGGCAGGG + Intronic
1122694923 14:103547839-103547861 GGGATGTCAGGGTGCAGGCGTGG - Intergenic
1122874956 14:104659693-104659715 GGGGGGTTGAGGTGTAGGCAGGG - Intergenic
1122924321 14:104892730-104892752 GGGATGGTGGGGGGCTGGGACGG - Intronic
1122938453 14:104970598-104970620 GGGATGTGGGGGTCCTGGCAGGG - Intronic
1124625267 15:31304164-31304186 GGGGGGTGGGGGTGCAGGCCAGG - Intergenic
1124626132 15:31308483-31308505 GGGAGGGTGGGGCCCAGGCAAGG - Intergenic
1126375029 15:47989007-47989029 TGGTAGTTGGGGTGCAGCCAGGG - Intergenic
1126506144 15:49406559-49406581 GGGAGGGTGGGGTGCTGGCCGGG + Intronic
1128340405 15:66818606-66818628 AAGATGGTGGGGTGGAGGCAGGG + Intergenic
1128547538 15:68578506-68578528 GCGAGGTGGGGGTGCGGGCAGGG + Intergenic
1128580866 15:68808737-68808759 GGGGTGATAGGGTGGAGGCAAGG - Intronic
1128759481 15:70206123-70206145 GGAAGGTTGGGGTGTAGACAGGG + Intergenic
1128793597 15:70449804-70449826 GGGATGGTTGGGTGGAGGGATGG + Intergenic
1129182433 15:73885663-73885685 GGGATGGTGGGGTGGAGGGAGGG - Intronic
1129391558 15:75223448-75223470 GGGGTGCTGGGGTGGGGGCATGG + Intergenic
1129521753 15:76190591-76190613 GGGATGTTGGGGTGGGGGAAAGG + Intronic
1129779706 15:78262569-78262591 GGGGTGGGGGGGTGCGGGCAGGG - Intergenic
1129969779 15:79768092-79768114 GGGATTTTAGTGTGCAGCCAAGG + Intergenic
1130984065 15:88833359-88833381 GGGAGCTTGGGGAGCAGGAAGGG - Intronic
1130988695 15:88861696-88861718 GTGATGGTGGGGTGCAGCTATGG - Intronic
1131189445 15:90301739-90301761 GGGATGTTGGGGAACAGATATGG + Intronic
1131441987 15:92466530-92466552 GGGATGGTGGGGTGCTGGCTTGG - Exonic
1131563260 15:93462631-93462653 GGTGTGTTGGTGTGCAGGGATGG - Intergenic
1132341025 15:101078743-101078765 CGGATGGTGGGATGCAGGCCCGG + Intergenic
1132374764 15:101321705-101321727 AGGATGCTGCGGTCCAGGCAGGG - Intronic
1133146758 16:3792976-3792998 CAGATGTTGGGATGCAGGAAGGG + Intronic
1133227266 16:4347589-4347611 GGGATGTTGGGGTACTGGATAGG - Intronic
1133440869 16:5819967-5819989 GGGATGTTGGCTTGTAAGCAAGG - Intergenic
1133609893 16:7423358-7423380 GGGGGGTGGGGGTGCAGGCAGGG + Intronic
1134221860 16:12361131-12361153 GGGATGTGGGGATGGAGGCCTGG + Intronic
1134849305 16:17468075-17468097 TGGAGCTTGGGTTGCAGGCAAGG - Intronic
1135015271 16:18919809-18919831 GGGTTGGGGGGGTCCAGGCACGG + Intronic
1135415346 16:22264616-22264638 GGGATGCTGGGTCACAGGCAGGG - Intronic
1137867852 16:51919473-51919495 GTGAGGTTGGGGTGTGGGCAAGG + Intergenic
1138588731 16:57987784-57987806 TGGGTGTGGGGCTGCAGGCAAGG - Intronic
1139307338 16:65998375-65998397 TGGATGGTGGGCTGCAGGAATGG + Intergenic
1140217387 16:73019495-73019517 GGGCTGCAGGGGTCCAGGCAGGG - Intronic
1140219447 16:73033197-73033219 GTTATGTGGGGGTGCTGGCAGGG - Intronic
1141183870 16:81773288-81773310 GAGTGGTTGGGGTGCAGACAAGG - Intronic
1141431963 16:83974941-83974963 GGGAGGTGTGGGTGCAGGGATGG + Intronic
1141432008 16:83975153-83975175 GGGAGGTGTGGGTGCAGGGATGG + Intronic
1141495474 16:84406722-84406744 CGGAAGTTGGGGTTCAGGGAAGG + Intronic
1142449887 16:90168444-90168466 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1142457199 17:63402-63424 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1142524147 17:526716-526738 GGGATGTGGGGGTGCAAGGGTGG + Intronic
1142611704 17:1112004-1112026 GGGATGTGGGGGTTGAGGGAAGG - Intronic
1144494296 17:15736918-15736940 GGGAAGATGGGGAGCAGGCAGGG + Intronic
1144729668 17:17519209-17519231 GGCAGGATAGGGTGCAGGCAGGG + Intronic
1144770625 17:17757494-17757516 GGGAAGGTGGAGCGCAGGCAAGG - Intronic
1144780725 17:17807197-17807219 GGGCGCTTGGGGTGCAGGGAGGG + Intronic
1144905969 17:18639758-18639780 GGGAAGATGGGGAGCAGGCAGGG - Intronic
1144922216 17:18773509-18773531 TGTAGGTGGGGGTGCAGGCATGG + Intronic
1144956802 17:19022794-19022816 GAGATCTTGGTGGGCAGGCAGGG - Intronic
1145271780 17:21408793-21408815 TGGATGGAGGGGTGGAGGCATGG - Intronic
1145279616 17:21457947-21457969 GGGATGGTGGGCAGCAGGCAGGG + Intergenic
1145309994 17:21696257-21696279 TGGATGGAGGGGTGGAGGCATGG - Intronic
1145398263 17:22512545-22512567 GGGAGGGTGGGCAGCAGGCAGGG - Intergenic
1146547771 17:33754093-33754115 GGGAGGCTGGGGTGGAGGAAGGG - Intronic
1146633907 17:34490206-34490228 GAGATGAGGGGGTGCAGCCAGGG + Intergenic
1147120866 17:38334422-38334444 GGTATGTTGGGGTGCTGGAGAGG + Intronic
1147133647 17:38422995-38423017 GGGGTCTTGGGAGGCAGGCAGGG - Intergenic
1147366125 17:39960414-39960436 GGGACAATGTGGTGCAGGCAGGG + Intergenic
1148068752 17:44893773-44893795 GGGGGGTGGGGGGGCAGGCATGG + Intronic
1148241822 17:46004207-46004229 GGGCTGTGGGGCTGCAGGCTTGG + Intronic
1148755284 17:49969870-49969892 GGGATGTGGGGGTGGGGGGAGGG + Intronic
1148911843 17:50947102-50947124 GGGTGGTGGGGGTGCAGGCTGGG + Intergenic
1149120563 17:53158683-53158705 GGGAGGTTGGGTTGGAGGGAGGG + Intergenic
1150269141 17:63851226-63851248 GGGATAGTGGGGTGAGGGCAGGG + Intergenic
1150433749 17:65138962-65138984 GGGATGCTGGGGTGGAGGAGGGG - Intronic
1150433757 17:65138982-65139004 GGGATGCTGGGGTGGAGGAGGGG - Intronic
1151013763 17:70531107-70531129 GGGATGGTGGGGTGGAGGGTGGG + Intergenic
1151013804 17:70531193-70531215 GGGATGGTGGGGTGGAGGGTTGG + Intergenic
1151401511 17:73858752-73858774 GGGGTGTTGGGGTGAATGGAGGG + Intergenic
1151623411 17:75261478-75261500 GGGACGTGGGGGTGAAGACAGGG + Intronic
1151731653 17:75914935-75914957 GGGATGTGGGGGTGAAGGCACGG + Intronic
1152327048 17:79647756-79647778 GGAAGGTTGGGGAGGAGGCAGGG - Intergenic
1152377761 17:79927550-79927572 GAGATGCTGGGGTGCAGGAGCGG + Intergenic
1152739642 17:82013318-82013340 GGGAGGGTGGGCTGCAGGCCTGG - Intronic
1152883124 17:82831736-82831758 GGGATTGTGGGGTGCATGTAAGG + Exonic
1153487892 18:5619152-5619174 GAGAGGTTGGGGTGGGGGCAGGG + Intronic
1153934507 18:9909246-9909268 CTGATGTTGGGGTGCAGGGAAGG - Intergenic
1155156989 18:23166010-23166032 AGGGTGTGGGTGTGCAGGCAAGG + Intronic
1155414358 18:25581454-25581476 GGAATGGTGGGGTGCAGCTATGG + Intergenic
1156096408 18:33538006-33538028 GGAGGGTTGGGGTGCAGGGAAGG + Intergenic
1157342547 18:46792177-46792199 GGGATTCTGAGGTGCAGCCAGGG - Intergenic
1157577277 18:48751786-48751808 GAGAAGTTGGGGTGGAGGCAGGG - Intronic
1157821638 18:50775755-50775777 GGGCGGTAGGGGTGGAGGCATGG - Intergenic
1159016158 18:63103048-63103070 GGGATGTGGAGGTGGAGGCAGGG + Intergenic
1160066247 18:75576793-75576815 CAGATGTTGGGGTGGGGGCAAGG - Intergenic
1160154419 18:76422687-76422709 GGGATGATGGGGGGCAGACATGG + Intronic
1160647558 19:200507-200529 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1160798316 19:955705-955727 GGGAAGGGGGGGTCCAGGCAGGG + Intronic
1160811075 19:1013169-1013191 GGGGTGCTGGGGTGCAGGCGGGG - Intronic
1160894458 19:1396102-1396124 GGGCTGGTGGGGTGGAGTCAGGG - Intergenic
1161091331 19:2361288-2361310 GGGTTGGTGGGGTGCAGGGCTGG + Intergenic
1161269594 19:3382548-3382570 GTGATGTGGTGGTCCAGGCAGGG + Intronic
1161329001 19:3677710-3677732 GGGATGGTGGGATGGAGGGATGG + Intronic
1161329398 19:3678997-3679019 GGGATGGTGGGATGGAGGGATGG + Intronic
1161404655 19:4084628-4084650 GGGTGGAGGGGGTGCAGGCAGGG - Intergenic
1161467980 19:4442710-4442732 CGGGTGGTGGGGGGCAGGCAGGG + Intronic
1161541184 19:4852355-4852377 TGGAAGTTGGGGTGCAGGGGAGG - Intronic
1161541216 19:4852451-4852473 TGGAAGTTGGGGTGCAGGGGAGG - Intronic
1162449764 19:10747734-10747756 AGGATGTTGAGGTGGGGGCAGGG + Intronic
1163220670 19:15917273-15917295 GGGACGTTGGGAGGGAGGCAAGG + Intronic
1163234429 19:16022574-16022596 GGGAGGTTTGGGGGCAGGCCTGG + Intergenic
1163571395 19:18084334-18084356 TGGATGGTGGGGTGGATGCATGG - Intronic
1163832063 19:19551808-19551830 GGGATGTTGGAGTGAGGGCCTGG + Intergenic
1164752319 19:30665983-30666005 GGGATCCTGGGGTCCAGGCTGGG + Intronic
1165304686 19:34996217-34996239 GGGGGGTTGGGGTGCAGGCGGGG - Intronic
1165424545 19:35738705-35738727 GGGCTGGAGGGGTGGAGGCAGGG - Exonic
1166100728 19:40570171-40570193 TGGAGGTGGGGGTGCAAGCAGGG - Intronic
1167203709 19:48085912-48085934 GGGATCTGGGAGTGCATGCAGGG - Intronic
1167382416 19:49146270-49146292 GGCATGTTCTGGTGAAGGCAGGG - Intronic
1167538235 19:50069033-50069055 GGCAGGTAGGGGTGCAGGCAGGG - Intergenic
1167561086 19:50226591-50226613 GGGATGAGGGAGTGCAGGCCCGG + Intronic
925184857 2:1840224-1840246 GGGTTTTTGGGGCCCAGGCATGG + Intronic
925202218 2:1977174-1977196 GGGATGTTAGGGAGGAGTCATGG - Intronic
926581447 2:14634993-14635015 GGGATGCGGGGGTGCAGCCCGGG - Exonic
926616909 2:15005282-15005304 GGGATGTTGGGGAGCGAGTAAGG - Intergenic
927488565 2:23505570-23505592 AGGCTGTTGGGATGCAGGGATGG - Intronic
927645332 2:24873647-24873669 GCCATGTTGGGGCCCAGGCATGG - Intronic
927934533 2:27068905-27068927 GGGATGGTGGAGGGCAGGAAGGG - Intronic
930057069 2:47260243-47260265 TGGAGGCTGGGGTGCAGGCATGG + Intergenic
931868753 2:66438120-66438142 GGGATGTAGGGCTTCAGGGATGG - Intronic
932105554 2:68937984-68938006 AGGAAGTTGGGGTGCAGGAAGGG - Intergenic
932455059 2:71844248-71844270 GGGATGCAGGGGTGGAGGAAGGG - Intergenic
932657153 2:73620065-73620087 GGGATGGTGGGGAGTGGGCATGG + Intergenic
932663826 2:73680308-73680330 GGGATGGTGGGGAGTGGGCATGG + Intergenic
936912792 2:117610173-117610195 GGGAGGTTGGGGGGAAGGGAGGG + Intergenic
937276060 2:120685083-120685105 GGGATGTTGGGCTGGAGGAGAGG + Intergenic
937309484 2:120893318-120893340 GGGAGGCTGGGGGGCGGGCAGGG - Intronic
937506080 2:122538285-122538307 GGGTTGTTGGAGTGTAGGTAGGG + Intergenic
938036730 2:128040895-128040917 GCGATGGTGGGGGGCAGGGAAGG - Intergenic
938536318 2:132252529-132252551 GGGCGGGTGGGGGGCAGGCAGGG + Intronic
938662951 2:133506116-133506138 GTGATGCTGAGGTGCAGGGAGGG - Intronic
939870449 2:147520575-147520597 CAGATGATGGGGAGCAGGCATGG + Intergenic
940325723 2:152423091-152423113 GAGATGTTTTGGTACAGGCATGG + Intronic
940780068 2:157923981-157924003 GGGTTGTTAGGGGGCAGGCCTGG + Intronic
941419786 2:165268992-165269014 GGGCTGTAGGGGTGGAGGAATGG + Intronic
941808550 2:169733901-169733923 GGGCTGTTCGGGTGGAGGCGGGG + Exonic
942580578 2:177412274-177412296 GGAAAGGTGGGGTGCACGCATGG + Intronic
943258707 2:185630360-185630382 GGAGTGATGGGGTGAAGGCATGG + Intergenic
945291056 2:208127975-208127997 CAGACGTTGGGGTGGAGGCAGGG - Intergenic
945833344 2:214810793-214810815 GGGATGTTGTGGAGCAGAGACGG - Intergenic
946253171 2:218425815-218425837 GGGAGGGTGGGCTGCAGGCCGGG + Intronic
946414834 2:219534809-219534831 AGGATGCTGGGATGCATGCATGG - Intronic
946524508 2:220504155-220504177 AGGATGTGGGGGGGCAGGCAGGG + Intergenic
946652959 2:221913913-221913935 GGGAGGATGGGGTGGAGCCACGG - Intergenic
947595633 2:231409853-231409875 GGGAGGCTGGGAGGCAGGCAGGG + Intergenic
947752622 2:232540712-232540734 GTGAGGAGGGGGTGCAGGCAGGG + Intronic
947842954 2:233220261-233220283 GGGGTGGTGGGGTGGGGGCACGG + Intronic
948157284 2:235793461-235793483 AGTCTGTTGGGGTGCTGGCAGGG + Intronic
948179934 2:235971827-235971849 GGGGTGTAGTGGTGCAGTCACGG + Intronic
948674653 2:239589758-239589780 TGGAGGTAGGGGTGCAGGCTGGG + Intergenic
948674668 2:239589819-239589841 TGGAGGTAGGGGTGCAGGCTGGG + Intergenic
948674683 2:239589880-239589902 TGGAGGTAGGGGTGCAGGCTGGG + Intergenic
948903009 2:240965605-240965627 GGGATGTTGGGGTGCGCCCGTGG - Intronic
949007230 2:241656557-241656579 GGGCTGGTGGGGAGCAGGCAGGG - Intronic
1169263339 20:4153196-4153218 GTGATTTTGGGGTGCTGGGAAGG + Intronic
1169688800 20:8307217-8307239 GGCACGTGTGGGTGCAGGCAGGG + Intronic
1170743485 20:19078180-19078202 GGTAGGATGGGGAGCAGGCAAGG + Intergenic
1171971403 20:31567223-31567245 GGGAGCTTTGGGAGCAGGCATGG + Intronic
1172612843 20:36264635-36264657 GGGATTGCGGGATGCAGGCAAGG - Intronic
1172687770 20:36769979-36770001 GGGTGGGTGGGGTGCAGGGAGGG + Intronic
1173309212 20:41881789-41881811 GGGATGTAGGGATTCAGGGATGG - Intergenic
1174947809 20:55007621-55007643 GGGATATTGGGGGGCATTCATGG + Intergenic
1175103734 20:56598947-56598969 GGGGTGCTGGGGAGCATGCAGGG + Intergenic
1175219186 20:57407281-57407303 GGGATGCGGGGGTGCAGTCTGGG + Intronic
1175934979 20:62510226-62510248 GGGATGGAGGGGTGAAGGTATGG - Intergenic
1175935007 20:62510302-62510324 GGGATGGAGGGGTGAAGGGATGG - Intergenic
1175935046 20:62510409-62510431 GGGGTGGAGGGGTGCAGGGATGG - Intergenic
1175974114 20:62701838-62701860 GGGACGTCGGGGTGCAGGGCAGG + Intergenic
1176011927 20:62902069-62902091 GGGCAGGTGGGGTGCAGGGATGG - Intronic
1176103553 20:63375498-63375520 GGGCTGCTGGGGTGCAGGGCTGG - Intronic
1176103569 20:63375546-63375568 GGGCTGATGGGGTGCAGGGCTGG - Intronic
1176103601 20:63375646-63375668 GGGCTGCTGGGATGCAGGGATGG - Intronic
1176103678 20:63375891-63375913 GGGCTGCTGGGGTGCAGGGATGG - Intronic
1176115374 20:63429777-63429799 AGGCTGGTGGGGTGCAGGGAGGG - Intronic
1177932388 21:27300829-27300851 AGAATATGGGGGTGCAGGCATGG - Intergenic
1179718427 21:43301942-43301964 GGGTGGTGGGGGTGCAGGCGGGG + Intergenic
1179956193 21:44740448-44740470 GGGAGAATGGGGTGGAGGCATGG + Intergenic
1180198047 21:46209011-46209033 GGGAGGTTGGGGCGCATGTATGG + Intronic
1180705681 22:17808444-17808466 GGGGTCTGGGGGTGCAGGCTGGG + Intronic
1181068084 22:20316017-20316039 GGGGTGTGGGGGCTCAGGCATGG - Intronic
1181431071 22:22882276-22882298 GCGGTGTTGGGGGGCAGTCATGG + Intronic
1181969280 22:26677982-26678004 AGGATATTGGGGTGGGGGCAGGG + Intergenic
1182570830 22:31236556-31236578 GGCATGTAGTGGTGCAGTCATGG - Intronic
1183369471 22:37424371-37424393 GGGATATTGAGGAACAGGCATGG + Intronic
1183811994 22:40265496-40265518 TGGATCTTGGGGTGCAGCTAGGG + Exonic
1184092436 22:42299655-42299677 GAAGTGTTGGGGTGCGGGCAGGG - Intronic
1184333696 22:43841160-43841182 GAGAGGCTGGGGTGCAGACAGGG + Intronic
1184981022 22:48096227-48096249 GGGGTGGGGAGGTGCAGGCAGGG + Intergenic
1185221082 22:49629593-49629615 GGGAGGCTGGGGTGCAGGGCTGG + Intronic
1185221103 22:49629657-49629679 GGGAGGCTGGGGTGCAGGGCTGG + Intronic
1185221124 22:49629721-49629743 GGGAGGCTGGGGTGCAGGGCTGG + Intronic
1185221145 22:49629785-49629807 GGGAGGCTGGGGTGCAGGGCTGG + Intronic
1185221156 22:49629817-49629839 GGGAGGCTGGGGTGCAGGGCTGG + Intronic
1185239538 22:49735270-49735292 GGGAGGGTGGGGGGCAGGGACGG - Intergenic
1185245431 22:49770607-49770629 TGGCTGGTGGGGTTCAGGCAGGG - Intergenic
1185333008 22:50260072-50260094 GGGGTGTCGAGGTGCGGGCAGGG + Intronic
950012514 3:9732972-9732994 GGAATGTTGGGGAGCGGGGAGGG + Intronic
950200882 3:11042856-11042878 TGGATGTCAGAGTGCAGGCACGG - Intergenic
950527615 3:13533548-13533570 AGGATCTTGGGGTGTTGGCAAGG + Intergenic
950528496 3:13538988-13539010 GAGATGATGGGGTTCAGACAGGG - Intergenic
952390330 3:32874206-32874228 GGTATGTTGGGGCCCAGGCTAGG - Intronic
953410580 3:42688437-42688459 GGGAGGTTGGGGGGCAGGGTGGG + Intronic
953523602 3:43667595-43667617 GGGAACTTAGGGTGCAGGGAAGG - Intronic
953633332 3:44639436-44639458 GGGCTTTTTGTGTGCAGGCAGGG + Intronic
954451044 3:50571907-50571929 GAGGTGTTGGGGTGCAGGAGTGG + Intronic
954656014 3:52194800-52194822 GGGGTGTTGGGGGGCAGCCTGGG - Intergenic
954956774 3:54528142-54528164 GAGATGTTGGTGTGCAGCCAGGG + Intronic
955393269 3:58536513-58536535 GGGCTGTGGGGGTGCTGGCAAGG + Intronic
955409242 3:58645220-58645242 AGGATAGTGGGGTGCAGACAGGG - Intronic
955617982 3:60829192-60829214 GGGAGGTAAGGATGCAGGCATGG - Intronic
956393015 3:68794667-68794689 GGCTTATTGGGCTGCAGGCAGGG - Intronic
960942835 3:122945827-122945849 GGGAGGTGGGGGTGGGGGCATGG + Intronic
962089723 3:132230494-132230516 TGGATGTGGGGGTGGAGGCCGGG - Intronic
962312797 3:134337973-134337995 GAGCTGTGGGGCTGCAGGCAGGG - Intergenic
962698488 3:137974213-137974235 GGGATGAAGGGGGGAAGGCATGG - Intergenic
964728723 3:159842687-159842709 GGGAGGTGGGGGTGCATGCCAGG - Intronic
965010249 3:163078460-163078482 GGGGTGTTGGGGGACAGACAGGG + Intergenic
966143846 3:176787677-176787699 GGGAGGGTGGGGTGGAGCCACGG - Intergenic
966826763 3:183971518-183971540 GGGGTGGTGGGGTGCGGGCAGGG + Intronic
967844807 3:194035039-194035061 GGGGTGTTGGGTGGCAGGCGGGG + Intergenic
967949837 3:194832207-194832229 GGGAAGTGGGGTTGCAGGGAAGG + Intergenic
968370284 3:198219606-198219628 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
968613673 4:1567972-1567994 CGGCTGTGGAGGTGCAGGCAGGG + Intergenic
968622047 4:1608256-1608278 GGGGTCTCAGGGTGCAGGCACGG - Intergenic
969098318 4:4750897-4750919 GGGATGTTGGACTGGGGGCAGGG - Intergenic
969233683 4:5850171-5850193 GGGATGTTGTCTTGCATGCATGG - Intronic
969300949 4:6296579-6296601 AGGAAGCTGGGGTGCTGGCATGG + Intronic
969422321 4:7104561-7104583 TTGAGGCTGGGGTGCAGGCAGGG - Intergenic
969466040 4:7357023-7357045 GGGACGGTGGGCTGCAGGGAGGG + Intronic
969675607 4:8612758-8612780 GGCATGGAGAGGTGCAGGCAGGG - Intronic
969983914 4:11187609-11187631 GGGAGCTTCTGGTGCAGGCAAGG + Intergenic
970239002 4:13988701-13988723 GGGAAGTTGGGATCCAGTCAAGG - Intergenic
971294836 4:25378834-25378856 TGGCTGTGTGGGTGCAGGCATGG + Intronic
971419445 4:26462069-26462091 GTGAGGTTGGAGTGCAGGAATGG - Intergenic
972351083 4:38236688-38236710 GGGATGTTGGTGTGAGGTCAGGG - Intergenic
974520076 4:62972137-62972159 GAGAGGTAGGGGTGCACGCATGG - Intergenic
977317962 4:95475015-95475037 GGGATGAAGTGGTGCAAGCAAGG - Intronic
979197319 4:117935973-117935995 GGGATGTGGGGGTGAGGGGAGGG - Intergenic
980756943 4:137177170-137177192 AGGATGGTGGGGTTCTGGCATGG + Intergenic
980795509 4:137677227-137677249 GGGATGATGGAGTGGAGCCATGG - Intergenic
980988504 4:139718389-139718411 GGGAGGCTGGTGTGGAGGCAAGG + Exonic
981268335 4:142814302-142814324 GGGATGTTGGGGAAAAGGCTGGG - Intronic
981300831 4:143184779-143184801 GGGAGGTGGGGGAGCAGGGAGGG + Intergenic
982021948 4:151213592-151213614 GGAATGCTGTGGTGCAGTCACGG - Intronic
982426424 4:155267362-155267384 GGCATTTTGGGGTGCTGCCAGGG + Intergenic
983622339 4:169774543-169774565 GAGGTGTTGGGGTGCACACAAGG + Intergenic
983784966 4:171718911-171718933 GGGGTGGTGGGGTGCATGCAGGG - Intergenic
985173595 4:187177560-187177582 GGGAAGTTGGGGGCGAGGCAAGG - Intergenic
985236806 4:187884043-187884065 GAGGTGTGGGGGTGCAGTCAAGG - Intergenic
985307087 4:188555137-188555159 GGGATCGGGGGGTGCAGGAACGG - Intergenic
985590071 5:759929-759951 GGGTCGCTGAGGTGCAGGCATGG + Intronic
987317817 5:16740396-16740418 GGGAGTTGGGGGTGCAGGTAGGG + Intronic
989598437 5:43179779-43179801 GACATGTTGGGTTGCAGGAAGGG - Intronic
990041812 5:51386029-51386051 GGGAAGTCGGGGTACAGGAAGGG + Intronic
990953623 5:61322440-61322462 AGAATGTTGGTGTGGAGGCAGGG - Intergenic
991202293 5:64008488-64008510 GGGAGGATGGGGTGGAGCCATGG + Intergenic
993164954 5:84340937-84340959 GGGATGATGCGGTGGTGGCAGGG - Intronic
993661116 5:90636155-90636177 GGCATGTCGGGGTGGGGGCAAGG - Intronic
993852883 5:93033325-93033347 GGGATGGAGGGGTGGAGGGATGG - Intergenic
994207656 5:97053469-97053491 GGGATGCAGGGATGCAGGGATGG - Intergenic
996531080 5:124527632-124527654 GGGGTGTGGGGGTGCAGGGAAGG + Intergenic
996677021 5:126188067-126188089 GGGAGGTTGGGGTGTAGCCTTGG + Intergenic
997233891 5:132261561-132261583 GCTATGTTGGGGTCAAGGCAGGG + Intronic
997612428 5:135224551-135224573 GGGATGTGGGGGTCAAGGCAAGG + Intronic
997614498 5:135237183-135237205 GGGTTGTTGGGGGACAGGCTGGG + Intronic
997856711 5:137379182-137379204 GGGATTGTGGGGTGGGGGCAGGG - Intronic
997931459 5:138075734-138075756 GGGATGTGGTGGTGCAGTCTTGG - Intergenic
998186231 5:139981889-139981911 GGGATGCTGGAGAGGAGGCATGG + Intronic
998987154 5:147772431-147772453 GGGGTGGTGGGGGGCAGGCTAGG + Intronic
1001280514 5:170383140-170383162 GGGATGTTGGGATGCAAGGATGG + Intronic
1002054933 5:176593440-176593462 GGGGTGCTAAGGTGCAGGCACGG + Intronic
1002099211 5:176849015-176849037 GGAATGAGGGGGTGCTGGCAAGG + Intronic
1002621891 5:180494169-180494191 GGGATGGAGGGCGGCAGGCAGGG + Intergenic
1002729816 5:181326366-181326388 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1003146960 6:3517117-3517139 GAGATGTTGGGGAGCAGGGGAGG - Intergenic
1003211382 6:4070943-4070965 GGGGTGTAGTGGTGCAGTCATGG - Intronic
1003488456 6:6599953-6599975 GGGATGTGGGTGTGCAGGAGAGG - Intronic
1003518130 6:6834748-6834770 GGGATGGTGGGGGGCGGGGAGGG - Intergenic
1003979034 6:11372114-11372136 GGGATTATGGGGGGCAGGTAGGG - Intronic
1004235176 6:13868666-13868688 GTGATGTGGGGGTGACGGCAGGG + Intergenic
1005632279 6:27719554-27719576 GGGATGTTGGGGCGCAGGGAAGG - Intergenic
1006601872 6:35231680-35231702 GGGGTCATGGGGTACAGGCAGGG - Intronic
1007263015 6:40576955-40576977 GGGGTGTCAGGGTGCAGGAACGG - Intronic
1007606078 6:43119144-43119166 GGCAGGGTTGGGTGCAGGCAGGG + Intronic
1007752200 6:44077271-44077293 GGGGTGTGGGGGTGGGGGCACGG - Intergenic
1008845412 6:55957393-55957415 GGGGTGGTAGGGGGCAGGCAGGG + Intergenic
1010896130 6:81366533-81366555 GGGATGTTTTGGATCAGGCATGG - Intergenic
1011655120 6:89544921-89544943 GGGATGTTTCGGGCCAGGCACGG + Intronic
1015002785 6:128240101-128240123 GGGATGTAGAGGTGAATGCAGGG - Exonic
1015908818 6:138146352-138146374 GGGGTGTTGGGGTGGTGACAGGG + Intergenic
1016121560 6:140348400-140348422 GACATGTTGGGTAGCAGGCAGGG + Intergenic
1016175925 6:141077638-141077660 GTGCTGTTGGGCGGCAGGCATGG + Intergenic
1017785013 6:157749256-157749278 TGGGTGATGGGGTGCAGTCAGGG + Intronic
1017949168 6:159121298-159121320 GGGAGGCTGGGGACCAGGCATGG + Intergenic
1018061617 6:160094070-160094092 GGAATGATGGGGTGGAGGTAGGG - Intronic
1018752902 6:166822618-166822640 GGGAGGTGGTGGGGCAGGCAGGG - Intronic
1018945804 6:168346046-168346068 GGGAAGCTGGGGGGCAGCCAGGG + Intergenic
1019103581 6:169650788-169650810 TGGATGGTGGGGTGGAGGGATGG - Intronic
1019324876 7:433122-433144 GGGGTGGTGGGCTTCAGGCACGG - Intergenic
1019452536 7:1107214-1107236 GGGATAGTGGGTTGCAGACAGGG - Intronic
1019455041 7:1122602-1122624 GGGATGCTGGGCAGCAGGCCTGG + Intronic
1019584997 7:1795733-1795755 TGCATGTTGGGGTCCTGGCAGGG + Intergenic
1019687642 7:2390600-2390622 AGGATGTGGGCGTGTAGGCAGGG - Intergenic
1019727648 7:2611906-2611928 GGGCGGGTGGGGTGAAGGCAGGG - Exonic
1019746047 7:2700880-2700902 GGGATGCCAGGGTGGAGGCAGGG + Intronic
1021782703 7:24121337-24121359 GGGATCTTTGGTTGAAGGCAAGG - Intergenic
1022972929 7:35533858-35533880 GGGGAGATGGGGGGCAGGCAAGG - Intergenic
1023401043 7:39793150-39793172 GGGATGCCGGGAGGCAGGCAGGG - Intergenic
1023439657 7:40172619-40172641 GAGATGTAGGGGCGCACGCATGG + Intronic
1024397876 7:48889899-48889921 GGGAAGATGGGGTGGAGCCATGG + Intergenic
1025052924 7:55743909-55743931 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1025282701 7:57639680-57639702 AGGATTGAGGGGTGCAGGCATGG - Intergenic
1025302016 7:57825737-57825759 AGGATTGAGGGGTGCAGGCATGG + Intergenic
1025901765 7:65750804-65750826 GGGATCTCAGGATGCAGGCAGGG - Intergenic
1027725813 7:81804713-81804735 TGGATGATGGAGTGTAGGCAAGG + Intergenic
1029193237 7:98786514-98786536 TGGAAGTTGGGGAGGAGGCAAGG - Intergenic
1029218279 7:98968307-98968329 GGAATGATGGGGGCCAGGCATGG - Intronic
1029300579 7:99579896-99579918 GAGATGTTGGGGTGCACACAGGG + Intronic
1029978754 7:104858593-104858615 GGGCTGTTGGGGTTCAGTGAGGG - Intronic
1030077859 7:105751817-105751839 GGGATGTGGGGGTAGAGACAGGG + Intronic
1030153131 7:106426194-106426216 GGAATGTTTGAGTGCAGGTAAGG - Intergenic
1031387397 7:121168497-121168519 GAGATGTTTTGATGCAGGCATGG + Intronic
1031643135 7:124190258-124190280 GAGGTGTTGGGTTGCAGGGATGG - Intergenic
1031990195 7:128192630-128192652 GGGATGGTGGGGAGGAGGGACGG - Intergenic
1032051532 7:128653487-128653509 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1032073830 7:128826763-128826785 GGAATGTTGGGTTGCAGGGAAGG + Intergenic
1032201358 7:129825304-129825326 GGGATGGTGGGGTGCTGGCTTGG - Intergenic
1032231200 7:130076038-130076060 GGGATGGTGGGGTGGAGGAGTGG + Intronic
1032344675 7:131107172-131107194 GGGATGTTGGGCTGCGCGGAGGG + Intergenic
1032538588 7:132684953-132684975 GGGATGTTGGGGTGAGGGCAGGG + Intronic
1032917254 7:136505993-136506015 GGCATGTTGGGATGCAGTAAGGG - Intergenic
1033082943 7:138314934-138314956 TGGTTGTTGGGGTGCAAGAATGG - Intergenic
1033149653 7:138902370-138902392 GGGGTGTTGGCTGGCAGGCAGGG - Intronic
1034256933 7:149729805-149729827 GAGATACTGGGGTGCAGGGATGG + Intronic
1034276451 7:149825966-149825988 GGGAGCTTTGGGTGGAGGCATGG + Intergenic
1034356527 7:150454518-150454540 AGGAGGATGGGGTGCAGGCAAGG + Intronic
1035110271 7:156475929-156475951 GGGGGGGTGGGGTGGAGGCAGGG - Intergenic
1035265837 7:157690020-157690042 GGGGTGGGGGGGTGCAGGCACGG - Intronic
1035389294 7:158495047-158495069 GGGTTCCTGGGGTGCTGGCATGG - Intronic
1035389643 7:158496491-158496513 GGGAAGGTGGGGCGCAGGGAAGG - Intronic
1035722176 8:1800109-1800131 GGGGTTCTGGGGTGCTGGCAGGG + Intergenic
1037788598 8:21918108-21918130 GGGAGGTTGGGGTGCGGGGGTGG + Intergenic
1037989039 8:23307464-23307486 AGGGGGTTGGGGAGCAGGCAGGG + Intronic
1038117079 8:24569104-24569126 GGGATGTTTGGGTGCAGTGTGGG - Intergenic
1039236631 8:35509347-35509369 GGGATGTAGGGGTACATGCCAGG + Intronic
1040491322 8:47924984-47925006 GGGATGTTGGGGTGCAGGCAGGG - Intronic
1040833803 8:51709541-51709563 GGGATTTTGGGGGCCAGGCATGG - Intronic
1044479271 8:92666378-92666400 TGGATGTTGGGGTCTAGGGAAGG - Intergenic
1045293212 8:100851413-100851435 GGCAGGCTGGGGAGCAGGCAAGG + Intergenic
1046006676 8:108494579-108494601 GGGGTGTGGGGGAGCAGGGAGGG - Intergenic
1046041696 8:108913612-108913634 TGCATGTGGGTGTGCAGGCAGGG + Intergenic
1046326968 8:112661863-112661885 GTGATGTTGGGGAGTAGGAATGG - Intronic
1047224350 8:122943867-122943889 GGGATTTTGGTCTGCAGGCAAGG - Intronic
1047292403 8:123541532-123541554 GGGCTGACGGGGTGCAGGGAGGG + Intergenic
1047551040 8:125872561-125872583 GAGGTGTTGGGGTGCGGGGAAGG - Intergenic
1047971169 8:130085939-130085961 TGGATGTTGTGGTTCTGGCAGGG + Intronic
1048475456 8:134738667-134738689 GGAATGTAGGGGTGCAGAGAGGG + Intergenic
1049141563 8:140959823-140959845 AGGGTGGTGGGGGGCAGGCAAGG - Intronic
1049225498 8:141448757-141448779 GGTGTGGTGGGGTGCAGGGAAGG + Intergenic
1049413850 8:142486189-142486211 GGGATGTAGGGGTGGGGGCCTGG - Intronic
1049970809 9:820449-820471 GGGAGGGCAGGGTGCAGGCAGGG + Intergenic
1050356717 9:4790927-4790949 GGGATGTTGGGGGGCAGGTGGGG + Intergenic
1051701475 9:19828876-19828898 AGGATGTTGGGATGGAGCCAAGG - Intergenic
1051727250 9:20101036-20101058 AAGATGTGGGGGTGAAGGCAGGG - Intergenic
1052937408 9:34104391-34104413 TGGATTATGGGGTGCAAGCATGG + Intronic
1053214418 9:36258591-36258613 GGTATTTTGAGGCGCAGGCAGGG + Intronic
1054743729 9:68833741-68833763 TGGATGTGGGGGTGAGGGCATGG + Intronic
1054781925 9:69173956-69173978 GGGGTGGAGGGGTGCAGGCGTGG + Intronic
1056232388 9:84559843-84559865 CCAGTGTTGGGGTGCAGGCAGGG - Intergenic
1056240678 9:84643593-84643615 AGAATGCTGGAGTGCAGGCATGG - Intergenic
1056374232 9:85991223-85991245 GGGGTGTGGGAGTCCAGGCAGGG + Intronic
1057226387 9:93295568-93295590 GGGCACTTGGGGTGAAGGCAAGG + Intronic
1057800279 9:98186844-98186866 GAGAGGTTGGGGTCCAGGCCAGG - Intronic
1058186730 9:101864045-101864067 GGACTGGTGGGGTGCAGGTATGG + Intergenic
1060532300 9:124355051-124355073 TGGATGCTAGGGTGCGGGCAGGG - Intronic
1060657949 9:125385697-125385719 GGGATGTTGGCGAGCTGGAATGG + Intergenic
1060796311 9:126514878-126514900 GGGAAGTTGAGGTTCAGGGAGGG - Intergenic
1060857515 9:126926769-126926791 GGGATGATGGGGTCCTGGCTAGG + Intronic
1060943357 9:127556029-127556051 GGGATGGAGGGGTGCGGGTAGGG - Intronic
1061036861 9:128118927-128118949 GGGATGGAGGGGTACAGGGATGG + Intergenic
1061036880 9:128118982-128119004 GGGATGGAGGGGTGCAGGGATGG + Intergenic
1061036901 9:128119034-128119056 GGGATGGAGGGGTGCAGGGATGG + Intergenic
1061036913 9:128119074-128119096 GGGACGGAGGGGTGCAGGGATGG + Intergenic
1061119475 9:128634390-128634412 GGGATGCAGGGGGCCAGGCAAGG + Intronic
1061202827 9:129147317-129147339 CGGTTGTTGGGGTCCTGGCAGGG + Intronic
1061274453 9:129561455-129561477 AGGATGATGGGGTGCAGGAAGGG + Intergenic
1062452709 9:136622254-136622276 GGGGGGTTGGGGGACAGGCAGGG - Intergenic
1062754228 9:138278878-138278900 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1203577788 Un_KI270745v1:21635-21657 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic
1185526815 X:786787-786809 GGAATGTTGGAGAGCAGGCTTGG - Intergenic
1186206420 X:7205228-7205250 AGGATGTTGGTGTGTAGGCAGGG - Intergenic
1186573752 X:10743876-10743898 GGGTTGGTGGGGTGCAGGGCGGG - Intronic
1186749338 X:12605626-12605648 AGGATGTGGGGTTGCAGGCAGGG - Intronic
1187717072 X:22113415-22113437 GGAAGCTGGGGGTGCAGGCAGGG - Intronic
1189454577 X:41174341-41174363 GGGGGGTGGGGGTGCAGGGATGG - Intronic
1190032994 X:46992297-46992319 GGGAAGCTGGGGTGGGGGCAGGG - Intronic
1190752901 X:53377431-53377453 TGGATGTGGGGGTGCAAGCAGGG + Exonic
1191210739 X:57882557-57882579 GGGATGTTGGGTTCCAGGGCAGG - Intergenic
1192205155 X:69090749-69090771 AGGACATTGGTGTGCAGGCATGG - Intergenic
1193600885 X:83507951-83507973 GTGTTGTTGGGGGGCAGTCAGGG - Intergenic
1194310524 X:92300878-92300900 GGTACGTTTTGGTGCAGGCAAGG + Intronic
1196430550 X:115620456-115620478 GAGATATTGGGGGGCAGGGATGG - Intronic
1198174894 X:134145531-134145553 GGTGAGTTGGGGTGGAGGCAGGG - Intergenic
1199613745 X:149639169-149639191 GGGGTGTTGGGTTGAATGCAAGG + Intergenic
1199872581 X:151912673-151912695 GGGAGGATGGGGTGCTGGTAGGG - Intronic
1200236047 X:154468236-154468258 GGAATGGTGGGGGGCAGGCCAGG - Intronic
1200851830 Y:7891480-7891502 GAGAGGTAGGGGTGCATGCATGG + Intergenic
1201764005 Y:17563214-17563236 GGGATGCTGGGGTTCTGCCATGG + Intergenic
1201837548 Y:18342776-18342798 GGGATGCTGGGGTTCTGCCATGG - Intergenic
1202380885 Y:24276088-24276110 GGGCTGCTGGGAGGCAGGCAGGG + Intergenic
1202489899 Y:25394037-25394059 GGGCTGCTGGGAGGCAGGCAGGG - Intergenic