ID: 1040491323

View in Genome Browser
Species Human (GRCh38)
Location 8:47924985-47925007
Sequence TGGGATGTTGGGGTGCAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 480
Summary {0: 1, 1: 0, 2: 3, 3: 46, 4: 430}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491323_1040491334 11 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data
1040491323_1040491336 17 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491336 8:47925025-47925047 GTGGGTGCCTCATCTGGCTTGGG No data
1040491323_1040491331 -1 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data
1040491323_1040491335 16 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491335 8:47925024-47925046 CGTGGGTGCCTCATCTGGCTTGG No data
1040491323_1040491330 -2 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491323 Original CRISPR TGGGATGTTGGGGTGCAGGC AGG (reversed) Intronic
900178818 1:1302551-1302573 TGAGATGTGGGGCTGCAGCCTGG - Intronic
902546563 1:17194097-17194119 CTGAATGTTAGGGTGCAGGCAGG - Intergenic
904370346 1:30044137-30044159 TGGGCTGGTGGGGGCCAGGCAGG - Intergenic
905339553 1:37268932-37268954 TGGGCTGTAGGGGGACAGGCAGG + Intergenic
906662720 1:47593947-47593969 TGGGGCTTAGGGGTGCAGGCAGG - Intergenic
906794426 1:48685746-48685768 TAGGAAGTAGGGGTGCAAGCAGG + Intronic
907461475 1:54608100-54608122 TGTGGTGTTGGGGTGGAGCCAGG - Intronic
909443206 1:75720736-75720758 AGGGTGGTTGGGGTGCAGGTTGG + Intergenic
910125744 1:83840118-83840140 TGGGAAGTTTGGGTACAGGTGGG + Intergenic
910861070 1:91742757-91742779 TGGGATGCTGAGGTGCACCCTGG + Intronic
912385851 1:109270857-109270879 TGGGAAGTAGGGCTGCGGGCAGG - Intronic
913093401 1:115494994-115495016 TGTGATGAGGGGGTACAGGCAGG - Intergenic
915450388 1:156001146-156001168 TGAGGTGATGGGGCGCAGGCAGG + Intronic
915486800 1:156226996-156227018 TGGGATCCTGGGGTCCAGGGTGG + Intronic
916212848 1:162372765-162372787 TTGGACTTTGGGATGCAGGCTGG + Intronic
916627156 1:166570629-166570651 TGGGATGTTGTGGTCGAGACTGG + Intergenic
917959331 1:180129773-180129795 CAGGAAGGTGGGGTGCAGGCTGG + Intergenic
918133484 1:181648879-181648901 AGGAATGTTGGGGTGCTGGGGGG + Intronic
920141938 1:203822399-203822421 TAGGATGTTGGGGTCCAAGCAGG - Intronic
920507681 1:206527865-206527887 TGGGCTGTTGAGGAGCAGCCAGG + Intronic
920714106 1:208323343-208323365 TGGGATGCTGTGGTGCAGCTGGG - Intergenic
920957642 1:210633776-210633798 TGGGTTGGTGGGATGCAGGGTGG - Intronic
921357314 1:214297715-214297737 TGAGGTGGTGGGGTGGAGGCGGG - Intronic
921717551 1:218433691-218433713 TGGGGAGTTGGGGTACAGGAAGG - Intronic
921925400 1:220706652-220706674 GGGGAGGCTGGGGTGAAGGCCGG - Intergenic
922734715 1:227972854-227972876 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
922781499 1:228256525-228256547 TGGGAGGTGGTGGTGCAGCCTGG + Intronic
923474626 1:234321099-234321121 TGGGAAATTGGGGTGCCTGCAGG - Intronic
923930730 1:238692977-238692999 TGGGGTGGTGGGGTGGAGGGGGG - Intergenic
924941121 1:248812936-248812958 GGGTAGGTGGGGGTGCAGGCTGG - Intronic
1063980782 10:11450064-11450086 TGGGCTGTCTGGCTGCAGGCAGG + Intergenic
1064712574 10:18141313-18141335 GAGGATGATGGGGTGCAGGTGGG + Intronic
1064988987 10:21239436-21239458 TGGGATGTGGGGGTGCAGAGTGG - Intergenic
1066221734 10:33341803-33341825 TGGGATGTTGGGGCGTGGACTGG + Intergenic
1066243817 10:33562742-33562764 TGGGAGGTTGGAGTGCAGTAAGG + Intergenic
1066309942 10:34186425-34186447 TGGGATTTTCAGGTGCAGGCTGG + Intronic
1066532766 10:36358390-36358412 TTGGAAGTTGGGGTGCAGAATGG - Intergenic
1067181056 10:43986294-43986316 TGGGATGAGGGGCTGCAGGCAGG - Intergenic
1069034164 10:63630352-63630374 TGGGAGGTTGCGGTGCAGGGTGG + Intergenic
1069558509 10:69413528-69413550 TGAGAGGGTGGGGTGCAGGGAGG + Intronic
1069607885 10:69751561-69751583 AGGGATGTGTGGCTGCAGGCAGG + Intergenic
1069659619 10:70114975-70114997 GGCGATGTTGGCGTGGAGGCCGG + Exonic
1069820029 10:71221653-71221675 TGTGATGCTGGGGTGCAAGGGGG + Intronic
1069838124 10:71322129-71322151 TGGGATGGTGGGGGGCGGGGAGG - Intronic
1070347309 10:75557468-75557490 TGGGATTTTGGGAGGCAGCCTGG + Intronic
1070561991 10:77575168-77575190 GGGGCTGTTGGGGAGCTGGCCGG - Intronic
1071499464 10:86193164-86193186 AGGGTGGTTGGGGTGCAGTCAGG + Intronic
1072818335 10:98531422-98531444 TTGGATGTGGGGCTGCAGCCAGG - Intronic
1073101627 10:101009540-101009562 TGGGGTATTGGGGTGCAGTTGGG - Intronic
1076409580 10:130236347-130236369 TGGGGTGGTGGGAGGCAGGCTGG + Intergenic
1076627297 10:131829853-131829875 TGGGATGTGGGGGTGAGGGTGGG - Intergenic
1077292214 11:1803087-1803109 GGTGATGCTGGGGTGCATGCTGG + Intergenic
1077328310 11:1973129-1973151 TGGGAGGTGGGAGGGCAGGCGGG - Intronic
1077508497 11:2943120-2943142 TGAGACCCTGGGGTGCAGGCAGG + Intergenic
1078856661 11:15210817-15210839 TGGGCTGGTGGGGTGGAGGGAGG + Intronic
1081384406 11:42454329-42454351 TGGGAGGTTGCGGTTGAGGCAGG - Intergenic
1081532190 11:43969693-43969715 TGGGAAGCTGGGGTGTGGGCAGG - Intergenic
1081693939 11:45096489-45096511 AGGGTTGTGGGGGTGCAGGCAGG + Intronic
1083196290 11:61090609-61090631 AGGGATGTTGGGAGGCTGGCCGG - Intergenic
1083276666 11:61600739-61600761 TGGGATGTGGGGGTCCAAGCTGG + Intergenic
1083612378 11:64010291-64010313 TGGGGTGTTGGAGTGTTGGCTGG + Intronic
1084440073 11:69167750-69167772 TTGGATTTTGGTGTACAGGCAGG + Intergenic
1084722919 11:70919741-70919763 TGGGAGGTTGGGGAGAGGGCTGG - Intronic
1085312060 11:75522659-75522681 TTGGATATGGGGGGGCAGGCAGG - Intronic
1085345424 11:75765427-75765449 TGGGTTGTTGGGGTGGAGGTGGG - Intronic
1090203467 11:124872103-124872125 TGGGAAATTGGGGCTCAGGCAGG + Intronic
1202811288 11_KI270721v1_random:28308-28330 TGGGAGGTGGGAGGGCAGGCGGG - Intergenic
1092876844 12:12856083-12856105 TGGGATGTTGGGGCCCATGCAGG - Intergenic
1094068634 12:26388333-26388355 TGGGATGTTGGGATTCAGTTAGG + Intronic
1095959304 12:47824103-47824125 TGTGACTTTGGGGTACAGGCAGG + Intronic
1096192672 12:49630660-49630682 GGGGAGTTGGGGGTGCAGGCTGG - Intronic
1096388289 12:51209851-51209873 TAGGATGAGGGGGTGCAGGAGGG + Intronic
1096408649 12:51361725-51361747 TGGAATGCTGGGGTGGGGGCCGG + Intronic
1096793211 12:54058068-54058090 TGGGATGTGGGGGGCCAGTCTGG + Intergenic
1098145780 12:67496546-67496568 TGGGGTGTTGGGGTACTGGGGGG + Intergenic
1098414215 12:70214882-70214904 TGGGTTGATGGGGTCCAGTCTGG + Intergenic
1100344178 12:93711025-93711047 TGGGAGGGTGGGGTGGAGGGGGG - Intronic
1101040154 12:100747379-100747401 TGGGGTGTAGGGAAGCAGGCAGG - Intronic
1101194361 12:102367840-102367862 TTGGATGTTGGGGGTCAGGCTGG - Intergenic
1101604115 12:106234915-106234937 TGGGAAGTCGTGGTCCAGGCTGG - Intergenic
1101748791 12:107565593-107565615 GGAGATGGAGGGGTGCAGGCTGG - Intronic
1101998861 12:109544297-109544319 AGGGAAGTTGGGGTGCTGGTGGG + Intergenic
1103702450 12:122855018-122855040 TGGGAAGTTCGGGTTCAGGAAGG - Intronic
1104040155 12:125124689-125124711 AGTGATGCTAGGGTGCAGGCGGG - Exonic
1104107450 12:125676673-125676695 TTTGATGTTGGGGTGGGGGCAGG + Intergenic
1104191991 12:126490840-126490862 TGGGAGGCTGAGGTGGAGGCAGG + Intergenic
1104691252 12:130828020-130828042 TGGGCTGCTGGGGAGGAGGCTGG - Intronic
1104722586 12:131053209-131053231 TGTGATGACGGAGTGCAGGCTGG + Intronic
1104953568 12:132453302-132453324 TGGCATATTGGGGTGCAGGGAGG - Intergenic
1105002821 12:132702363-132702385 TGGGCTGGTGGTGTGGAGGCTGG + Intronic
1105966444 13:25388829-25388851 GGGGAAGTTGGGGTGAGGGCAGG + Intronic
1106025580 13:25952610-25952632 TGGGATGCTGAGGTGAAGGACGG - Intronic
1107707187 13:43119673-43119695 TCAGATGTGCGGGTGCAGGCTGG - Intergenic
1111907279 13:94269921-94269943 GTTGATGTTGTGGTGCAGGCAGG + Intronic
1112215191 13:97423248-97423270 TGTAATGTTGGGGTAGAGGCGGG + Intergenic
1113513032 13:110870828-110870850 TGGGACGATGGGTTGCAGGGAGG - Intergenic
1113662290 13:112115955-112115977 TGGGAGGTTGTGTTGAAGGCGGG - Intergenic
1113676356 13:112210053-112210075 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676374 13:112210097-112210119 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676392 13:112210141-112210163 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676423 13:112210229-112210251 TAGGCAGGTGGGGTGCAGGCAGG + Intergenic
1113676432 13:112210251-112210273 GGGGCAGGTGGGGTGCAGGCAGG + Intergenic
1114447804 14:22802884-22802906 TGGGGTGTGGGGGTGCATGGGGG - Intronic
1114543765 14:23483367-23483389 TGGGAGTCTGGGGTGCAGGTGGG - Intronic
1114862105 14:26536219-26536241 TGGGCGGTTGGGGAGAAGGCGGG + Intronic
1117567880 14:57014969-57014991 GGGGTTGGGGGGGTGCAGGCAGG - Intergenic
1118254910 14:64197033-64197055 TGGGAGGTGGAGGTGCAGCCGGG + Intronic
1119425659 14:74533359-74533381 TGGCATGTTGAGATGCAGACAGG + Intronic
1119616561 14:76102541-76102563 TGTGGTGTTGGGGGGCGGGCGGG + Intergenic
1119675031 14:76547168-76547190 TGGGGTGATTGTGTGCAGGCTGG + Intergenic
1120751559 14:88203027-88203049 TGGGAGGTGGGGTGGCAGGCAGG + Intronic
1120780662 14:88482805-88482827 GGGGATGTGGGGGTGCTGGGAGG + Intronic
1121224491 14:92311324-92311346 TGGGAGGTGGGGGTGCTGGGTGG - Intergenic
1122061244 14:99138098-99138120 TGGGATGTTAAGGAGAAGGCAGG - Intergenic
1122550451 14:102546235-102546257 GCGGATGGTGGGGGGCAGGCAGG + Intergenic
1122641199 14:103160678-103160700 AAGGTTGTAGGGGTGCAGGCAGG - Intergenic
1122938454 14:104970599-104970621 TGGGATGTGGGGGTCCTGGCAGG - Intronic
1123398717 15:19963199-19963221 TGCCATGTTGGGGTGCACTCTGG - Intergenic
1124100352 15:26687080-26687102 TGGGAAGTGAGGGTGCAGGGAGG + Intronic
1124340430 15:28886443-28886465 TGGGATATGGGGGTACAGCCCGG + Intronic
1124966658 15:34437211-34437233 TGGGATCTAGGGGTGCAGCCCGG - Intronic
1124983277 15:34583329-34583351 TGGGATCTAGGGGTGCAGCCCGG - Intronic
1125724331 15:41860685-41860707 TGGGACCTGGAGGTGCAGGCGGG - Exonic
1126227594 15:46289584-46289606 TGTGATGGTGGGATGCTGGCAGG + Intergenic
1126324428 15:47461224-47461246 TGAGATGATGAGGTGCAGGTGGG - Intronic
1126375030 15:47989008-47989030 TTGGTAGTTGGGGTGCAGCCAGG - Intergenic
1126506143 15:49406558-49406580 CGGGAGGGTGGGGTGCTGGCCGG + Intronic
1127868815 15:63053293-63053315 TGGGGAGTTGGGGTGGGGGCCGG + Intronic
1128245959 15:66132994-66133016 TGAGAGGTTGGGGTGGAGGTTGG - Intronic
1128914364 15:71546447-71546469 TGGGAGCATGGGGAGCAGGCTGG - Intronic
1129118730 15:73381837-73381859 TGGGATGTTGGGGCAGAGGAAGG - Intergenic
1129179678 15:73866154-73866176 TGGGATGGAGGGGTACAGGGAGG - Intergenic
1129182434 15:73885664-73885686 AGGGATGGTGGGGTGGAGGGAGG - Intronic
1131030914 15:89185372-89185394 TGCGGTGTGGGGGTGCAGGCGGG - Intronic
1131414849 15:92245772-92245794 TGGGAGTTTGGGGAGGAGGCAGG + Intergenic
1132111113 15:99103031-99103053 TGGGACATTGGGGTGCGGGGGGG - Intronic
1132524316 16:406794-406816 TGGGAGGCTGAGGTGCCGGCCGG - Intronic
1132524328 16:406850-406872 TGGGAGGCTGAGGTGCCGGCCGG - Intronic
1132929812 16:2453340-2453362 TGGGGTGCTGGGGTGTGGGCGGG + Intronic
1133609892 16:7423357-7423379 TGGGGGGTGGGGGTGCAGGCAGG + Intronic
1134005225 16:10814572-10814594 TGGGTTGTTGGGGTGGAAGTAGG - Intronic
1134110119 16:11510134-11510156 TGAGATGTGGGGGTCCAAGCGGG - Intronic
1134719260 16:16371765-16371787 TGGGCTGTTGGGGGCCTGGCCGG + Intergenic
1134948166 16:18340120-18340142 TGGGCTGTTGGGGGCCTGGCCGG - Intergenic
1135987637 16:27195702-27195724 TGGTCTGCTGGGGTGGAGGCAGG - Intergenic
1136631956 16:31494016-31494038 TGGGAGGTTGTGGAGCAGGGAGG - Intronic
1137736325 16:50726514-50726536 TGGGAAGTTGGGGTGAAGCCCGG + Intronic
1137771971 16:51023674-51023696 TGGGATGTTGGGGTGGGTGTTGG + Intergenic
1138025580 16:53519947-53519969 TGGGAGGTTGAGGTGGAGGATGG - Intergenic
1138416668 16:56875621-56875643 TGAGCTGTTGGGGTGGGGGCAGG - Intronic
1139948272 16:70656534-70656556 TGGGAGGTTGGGGAGCCTGCTGG + Intronic
1142147560 16:88498956-88498978 TGGGGTCTGGTGGTGCAGGCAGG - Intronic
1142640388 17:1281821-1281843 TGGGGTGGCAGGGTGCAGGCTGG + Intronic
1142778805 17:2164174-2164196 TGGGAGGCTGAGGTGGAGGCGGG + Intronic
1142806073 17:2371975-2371997 TGGGTGGTTGGGGGCCAGGCGGG + Intronic
1143278249 17:5730740-5730762 TAAGATGTTGGGGTCCACGCTGG - Intergenic
1143895452 17:10132908-10132930 AGGGATGTTGGGGTGGAGGTCGG - Intronic
1144354798 17:14435071-14435093 TGTGATTTTGGGGTGCAGCTAGG + Intergenic
1144494295 17:15736917-15736939 GGGGAAGATGGGGAGCAGGCAGG + Intronic
1144622004 17:16823861-16823883 TGGGAGGGTGGGGTGGGGGCCGG - Intergenic
1144729667 17:17519208-17519230 TGGCAGGATAGGGTGCAGGCAGG + Intronic
1144775758 17:17783758-17783780 TGGGGTGCTGAGGTGTAGGCGGG + Intronic
1144905970 17:18639759-18639781 GGGGAAGATGGGGAGCAGGCAGG - Intronic
1144956803 17:19022795-19022817 TGAGATCTTGGTGGGCAGGCAGG - Intronic
1145279615 17:21457946-21457968 AGGGATGGTGGGCAGCAGGCAGG + Intergenic
1146955935 17:36936436-36936458 TGGAAGGTTGGGGTGCAGCCGGG - Intergenic
1147175684 17:38654849-38654871 GTGGATGGTGGGGTGCCGGCAGG + Intergenic
1147366124 17:39960413-39960435 TGGGACAATGTGGTGCAGGCAGG + Intergenic
1147573975 17:41588195-41588217 TGGGAGGGTGGGGTGGGGGCCGG - Intergenic
1148073000 17:44919593-44919615 TGGGGGGTTTGGGTGGAGGCTGG - Intergenic
1148085435 17:44990964-44990986 TGGGAGGTGGAGGTGGAGGCAGG + Intergenic
1148755283 17:49969869-49969891 TGGGATGTGGGGGTGGGGGGAGG + Intronic
1148837902 17:50476058-50476080 TGGGAGGTAAGGGGGCAGGCAGG - Intergenic
1148883583 17:50753910-50753932 TGGGATGTGGGGGTGGTGGGAGG + Exonic
1148911842 17:50947101-50947123 GGGGTGGTGGGGGTGCAGGCTGG + Intergenic
1149120562 17:53158682-53158704 TGGGAGGTTGGGTTGGAGGGAGG + Intergenic
1150433750 17:65138963-65138985 GGGGATGCTGGGGTGGAGGAGGG - Intronic
1150433758 17:65138983-65139005 GGGGATGCTGGGGTGGAGGAGGG - Intronic
1151013762 17:70531106-70531128 GGGGATGGTGGGGTGGAGGGTGG + Intergenic
1151524266 17:74653233-74653255 TGGGATGTAGGGGTGGTGGTGGG - Intergenic
1151617140 17:75220855-75220877 TGGGATGGTGGGATGGAGGGAGG - Intronic
1152109749 17:78351489-78351511 TGGAAGGCTGGGCTGCAGGCTGG - Intergenic
1152274660 17:79349275-79349297 TGGGAGGAGAGGGTGCAGGCAGG - Intronic
1152327049 17:79647757-79647779 TGGAAGGTTGGGGAGGAGGCAGG - Intergenic
1152630409 17:81408409-81408431 TGAGAGGTGGGGGTGCAGGGTGG - Intronic
1152678100 17:81651811-81651833 TGGGAGGTTGGGGAGGAGGCGGG - Intronic
1152807196 17:82361781-82361803 AGGGATGTTGGGGTTCAGACTGG - Intronic
1153706230 18:7748434-7748456 TGGGATGTGGATGTGCTGGCTGG + Intronic
1156450203 18:37262476-37262498 TGGGATGGTGGAGTGTAGGGTGG + Intronic
1157130518 18:45002932-45002954 TGGGTTGTTGGGGTGGAGGTGGG + Intronic
1157177925 18:45468033-45468055 TGGGAGGTGGGGGTGGTGGCTGG - Intronic
1157342548 18:46792178-46792200 TGGGATTCTGAGGTGCAGCCAGG - Intergenic
1157577278 18:48751787-48751809 AGAGAAGTTGGGGTGGAGGCAGG - Intronic
1157600374 18:48889716-48889738 TGGGTTGATGGGGAGCAGGGAGG - Intergenic
1159016157 18:63103047-63103069 TGGGATGTGGAGGTGGAGGCAGG + Intergenic
1159467259 18:68800317-68800339 TGGGATTTTAGGGTGCAGGGAGG + Intronic
1160517518 18:79486731-79486753 TGGGCTGCAGGGCTGCAGGCAGG - Exonic
1160811076 19:1013170-1013192 TGGGGTGCTGGGGTGCAGGCGGG - Intronic
1160895741 19:1401155-1401177 TGGGAAGTGGGGCTGCAGGTGGG - Intronic
1161016911 19:1987722-1987744 CGGGATCCTGGGGTGCAGCCCGG - Intronic
1161089220 19:2351868-2351890 TGGGACGCGGGGGTGCCGGCTGG + Intronic
1161269593 19:3382547-3382569 TGTGATGTGGTGGTCCAGGCAGG + Intronic
1162015990 19:7846705-7846727 TGAAATCTTGGGGTGCAGTCTGG + Intronic
1162087353 19:8256750-8256772 CGGGATGCTGGGGTGCTGGGGGG + Intronic
1162449763 19:10747733-10747755 TAGGATGTTGAGGTGGGGGCAGG + Intronic
1162695347 19:12469422-12469444 TGGGATGTTAGAGCACAGGCAGG + Intronic
1162992453 19:14312384-14312406 TGGCATCTCGGGGTGGAGGCCGG + Intergenic
1163323331 19:16587322-16587344 TGGGGTCTTGGGGTGGAGGTGGG - Intronic
1163415632 19:17184822-17184844 TGGGCTGTGGGAGGGCAGGCCGG + Intronic
1163458958 19:17424968-17424990 TGAGACGCTGGGGGGCAGGCGGG - Exonic
1163567953 19:18062846-18062868 AGGGTTGGTGGGGGGCAGGCAGG - Intronic
1163752033 19:19083871-19083893 TGGGGTGGTGGGGTGTGGGCAGG - Intronic
1163752053 19:19083931-19083953 TGGGGTGGTGGGGTGCGGGCAGG - Intronic
1163752070 19:19083991-19084013 TGGGGTGGTGGGGTGTGGGCAGG - Intronic
1163752090 19:19084051-19084073 TGGGGTGGTGGGGTGCAGTCAGG - Intronic
1163752120 19:19084156-19084178 TGTGGTGGTGGGATGCAGGCAGG - Intronic
1163820925 19:19496194-19496216 TGGGATGTTGACGAGCAGGCTGG - Exonic
1164752318 19:30665982-30666004 TGGGATCCTGGGGTCCAGGCTGG + Intronic
1165174012 19:33914048-33914070 GAGGATGTGGGGGTGCAAGCAGG - Intergenic
1165304687 19:34996218-34996240 CGGGGGGTTGGGGTGCAGGCGGG - Intronic
1165424546 19:35738706-35738728 TGGGCTGGAGGGGTGGAGGCAGG - Exonic
1165424860 19:35740133-35740155 TGGGAGGTTTGGGAGCGGGCAGG - Intronic
1165430224 19:35767886-35767908 TGGGACCTCGGGCTGCAGGCAGG - Exonic
1165718782 19:38064013-38064035 GGGGATGATGGGATGCAGTCAGG - Intronic
1166062646 19:40336275-40336297 TGGGGTGGTGGGGAGCTGGCTGG - Intronic
1166325954 19:42051340-42051362 TCTGGTGATGGGGTGCAGGCTGG - Intronic
1166678065 19:44751285-44751307 TGGGGTATAGGGGTGTAGGCAGG - Exonic
1166763699 19:45239982-45240004 GGGGATGAGGGGGTGTAGGCAGG - Intronic
1167203710 19:48085913-48085935 TGGGATCTGGGAGTGCATGCAGG - Intronic
1167245611 19:48371333-48371355 TGGGGTGGTGGGGAGGAGGCTGG - Intronic
1167382417 19:49146271-49146293 TGGCATGTTCTGGTGAAGGCAGG - Intronic
1167538236 19:50069034-50069056 GGGCAGGTAGGGGTGCAGGCAGG - Intergenic
1167567803 19:50267810-50267832 TGGGAGGCTGGGGAGGAGGCTGG + Intronic
1168073381 19:53964833-53964855 TGTGAGGCTGGGGTGCAGGAGGG - Intronic
1168322077 19:55516901-55516923 TGGGGTGCTGGGGTGCGGGAGGG - Intronic
925184279 2:1836477-1836499 TGGAATTTTGGGGTGCAGGCTGG - Intronic
926418148 2:12671132-12671154 TGGGAGGATGGGGTCCAAGCAGG - Intergenic
926581448 2:14634994-14635016 GGGGATGCGGGGGTGCAGCCCGG - Exonic
927210740 2:20637582-20637604 TGGGAGGGTGGGCTGCAGGGTGG - Intronic
928388362 2:30888908-30888930 TGGGAGGTGGGGGTGGAGGGGGG - Intergenic
929457859 2:42078607-42078629 TGGGATGTTGTGGGGCTGGATGG - Intergenic
929791140 2:45024029-45024051 TGGGTACTTGGGGTGCAGGGAGG + Intergenic
930146859 2:48016453-48016475 TGGGATGATGTAGAGCAGGCTGG - Intergenic
931142217 2:59474180-59474202 TGGTATGTTGGGGTGGAGAAAGG + Intergenic
932105555 2:68937985-68938007 TAGGAAGTTGGGGTGCAGGAAGG - Intergenic
934736329 2:96691638-96691660 TGGGAGGTGGGGTTACAGGCAGG - Intergenic
934884760 2:98014606-98014628 TGGGATGGTGGGCTGGTGGCTGG - Intergenic
934884771 2:98014637-98014659 TGGGATGGTGGGCTGGTGGCTGG - Intergenic
935179205 2:100675175-100675197 TGGCAGTTGGGGGTGCAGGCTGG - Intergenic
936262308 2:110972169-110972191 AGGGATGCTGGGCTGCAGGGAGG + Intronic
936581787 2:113706407-113706429 TAGGATGGTGGGGTGGAGGGAGG - Intronic
937059453 2:118970697-118970719 TGGGTGGTAGGGCTGCAGGCTGG + Intronic
937506079 2:122538284-122538306 TGGGTTGTTGGAGTGTAGGTAGG + Intergenic
937788060 2:125925481-125925503 TGTGATGATGGGGTACTGGCTGG - Intergenic
937972236 2:127559719-127559741 CAGGATGTCGGGGTTCAGGCTGG + Exonic
938662952 2:133506117-133506139 TGTGATGCTGAGGTGCAGGGAGG - Intronic
941808549 2:169733900-169733922 GGGGCTGTTCGGGTGGAGGCGGG + Exonic
942396232 2:175552693-175552715 TTGGGTGTTGGGGGGCAGGGGGG - Intergenic
943521009 2:188949384-188949406 TGGGAAGGTGGGGTGGAGGGTGG - Intergenic
945291057 2:208127976-208127998 TCAGACGTTGGGGTGGAGGCAGG - Intergenic
945811366 2:214553966-214553988 TGGGATCTTAGGGTGCCAGCAGG - Intronic
945987509 2:216367113-216367135 TGGGGTGATGGGGAGCAGGGAGG + Intronic
946253170 2:218425814-218425836 AGGGAGGGTGGGCTGCAGGCCGG + Intronic
946524507 2:220504154-220504176 CAGGATGTGGGGGGGCAGGCAGG + Intergenic
947595632 2:231409852-231409874 TGGGAGGCTGGGAGGCAGGCAGG + Intergenic
947727735 2:232410321-232410343 TGGGAGGGTGGGTTGCAGGGTGG - Exonic
948569073 2:238906108-238906130 TGGGCTGCTGGGGTGAAGCCTGG + Intronic
948587750 2:239029907-239029929 AGGGATTTGGGGGTGCAGGGTGG + Intergenic
948674652 2:239589757-239589779 ATGGAGGTAGGGGTGCAGGCTGG + Intergenic
948674667 2:239589818-239589840 ATGGAGGTAGGGGTGCAGGCTGG + Intergenic
948674682 2:239589879-239589901 ATGGAGGTAGGGGTGCAGGCTGG + Intergenic
949007231 2:241656558-241656580 GGGGCTGGTGGGGAGCAGGCAGG - Intronic
1169367004 20:5000664-5000686 TAGGATGTCGGCCTGCAGGCTGG - Intronic
1169739946 20:8881243-8881265 TGGGAGGTTGAGGTTGAGGCAGG - Intronic
1171247592 20:23625010-23625032 GGGGTTGGTGGGGTGCAGGTAGG + Intergenic
1173588833 20:44208445-44208467 TAAGAAGTTGAGGTGCAGGCTGG - Intronic
1175103733 20:56598946-56598968 TGGGGTGCTGGGGAGCATGCAGG + Intergenic
1175219185 20:57407280-57407302 TGGGATGCGGGGGTGCAGTCTGG + Intronic
1175366850 20:58461595-58461617 AGAGAAGTTGGGGTGCAGCCTGG + Intronic
1175990987 20:62789036-62789058 TAGACAGTTGGGGTGCAGGCTGG - Intergenic
1177147268 21:17420313-17420335 TGGGGTGTTGGGCTGCATGCTGG - Intergenic
1177157244 21:17512606-17512628 TGGGACGGGTGGGTGCAGGCGGG + Exonic
1178684953 21:34703389-34703411 TGGGGTGTTGAGGAGCAGCCAGG + Intronic
1179494971 21:41766053-41766075 TGGGAAACTGGGGTGCAGGAGGG + Intronic
1179547641 21:42123305-42123327 TCCGATTCTGGGGTGCAGGCTGG - Intronic
1179718426 21:43301941-43301963 AGGGTGGTGGGGGTGCAGGCGGG + Intergenic
1179718470 21:43302227-43302249 TGGGGTGTGTGGGTGCAGCCAGG - Intergenic
1179893766 21:44350476-44350498 TGGGGTGCAGGGGCGCAGGCGGG + Intronic
1180180299 21:46115951-46115973 TGGGGCGCTGGGCTGCAGGCGGG - Intronic
1180702486 22:17789222-17789244 GTGGATGCTGGGATGCAGGCTGG - Exonic
1180705680 22:17808443-17808465 GGGGGTCTGGGGGTGCAGGCTGG + Intronic
1180994498 22:19958956-19958978 GGGGGCGGTGGGGTGCAGGCCGG - Intronic
1181601043 22:23952053-23952075 TGGGATTTTGGGGTGGGGGTGGG + Intergenic
1181607466 22:23989273-23989295 TGGGATTTTGGGGTGGGGGTGGG - Intergenic
1181734128 22:24868560-24868582 AGGGAGGCTGGGGTGGAGGCTGG + Intronic
1181969279 22:26677981-26678003 TAGGATATTGGGGTGGGGGCAGG + Intergenic
1182137362 22:27918861-27918883 TGGGGGGTTGGGGAGAAGGCGGG + Intronic
1182856542 22:33522450-33522472 TGGGAGGTGGAGGTGGAGGCGGG + Intronic
1183811993 22:40265495-40265517 TTGGATCTTGGGGTGCAGCTAGG + Exonic
1183980641 22:41537900-41537922 TGGGAGGTGGAGGTGGAGGCAGG - Intronic
1184092437 22:42299656-42299678 TGAAGTGTTGGGGTGCGGGCAGG - Intronic
1184659474 22:45959311-45959333 TGTGAAGTGGGGGTGCAAGCTGG - Intronic
1184675916 22:46043530-46043552 TGGGCTGGTGGGGCGCTGGCTGG - Intergenic
1184980927 22:48095941-48095963 TGGGATGGCGAGGTGCAGGTGGG + Intergenic
1184980962 22:48096055-48096077 TGGGATGGGGAGGTGCAGGCGGG + Intergenic
1184980975 22:48096093-48096115 CGGGATGGGGAGGTGCAGGCGGG + Intergenic
1185400601 22:50613655-50613677 TGGGATGCAGGGGTGGGGGCGGG - Intronic
1203241583 22_KI270733v1_random:24522-24544 TGGGATTTTAGTCTGCAGGCCGG + Intergenic
949945308 3:9185213-9185235 TGGGAGGTTGGAATCCAGGCAGG - Intronic
950039016 3:9907782-9907804 TGGGATGCTGGGGCCCAGGTTGG - Intronic
950873497 3:16249556-16249578 TAGGCTGTTGGGGAGCAGCCTGG + Intergenic
951034077 3:17913856-17913878 AGGGATGTAAGGGTGGAGGCAGG + Intronic
951995978 3:28729459-28729481 TGGTGGGTTGGAGTGCAGGCTGG - Intergenic
953410579 3:42688436-42688458 GGGGAGGTTGGGGGGCAGGGTGG + Intronic
953633331 3:44639435-44639457 TGGGCTTTTTGTGTGCAGGCAGG + Intronic
954656015 3:52194801-52194823 TGGGGTGTTGGGGGGCAGCCTGG - Intergenic
954956773 3:54528141-54528163 GGAGATGTTGGTGTGCAGCCAGG + Intronic
955060698 3:55489432-55489454 TGGGGTGTGGGGGTGGAGGTGGG - Intronic
955229312 3:57084900-57084922 TGGTAGGGTGGGGTGCAAGCTGG + Intergenic
956393016 3:68794668-68794690 TGGCTTATTGGGCTGCAGGCAGG - Intronic
959572934 3:107904894-107904916 TGGGAGGATGGGGTGGAGCCTGG - Intergenic
962089724 3:132230495-132230517 GTGGATGTGGGGGTGGAGGCCGG - Intronic
964767564 3:160193511-160193533 TGGGGTTTTGAGGGGCAGGCAGG + Intergenic
965010248 3:163078459-163078481 TGGGGTGTTGGGGGACAGACAGG + Intergenic
966826762 3:183971517-183971539 TGGGGTGGTGGGGTGCGGGCAGG + Intronic
967216832 3:187218318-187218340 TGGGATGTTGGGGTGTGCCCAGG + Intronic
967844806 3:194035038-194035060 AGGGGTGTTGGGTGGCAGGCGGG + Intergenic
968707245 4:2085524-2085546 TGCGTGGTTGGTGTGCAGGCGGG - Intronic
968920227 4:3518674-3518696 GGGGAGGTTGCTGTGCAGGCAGG - Intronic
969870834 4:10103767-10103789 TGGGGGGTGGGGGAGCAGGCTGG - Intronic
969872201 4:10111589-10111611 TGGCCTGTGGGGGTGCAGGATGG - Intronic
970002245 4:11375589-11375611 TGGGATTTTAGGGTGCAGAGAGG + Intergenic
970157697 4:13158207-13158229 TGTGATGCTGGGGTGGAGGGTGG - Intergenic
973290598 4:48466529-48466551 TGGAAGGCTGGGGTGCAGACAGG - Intergenic
975143193 4:70938924-70938946 TGGGAGGTCGAGGTGCTGGCAGG - Intronic
977207932 4:94184447-94184469 TGGGATGTAGGAGTCCAGGAAGG + Intergenic
978618554 4:110618823-110618845 TGGTATCTTGGTGTGCAGGGCGG - Intronic
979197320 4:117935974-117935996 TGGGATGTGGGGGTGAGGGGAGG - Intergenic
980314107 4:131174096-131174118 AATGATGTTGGGGTGCATGCAGG - Intergenic
981268336 4:142814303-142814325 TGGGATGTTGGGGAAAAGGCTGG - Intronic
983784967 4:171718912-171718934 TGGGGTGGTGGGGTGCATGCAGG - Intergenic
985393352 4:189514898-189514920 GGGGATGGTGGGGGGCAGGTGGG - Intergenic
985475633 5:77328-77350 TGGGATGAGGCTGTGCAGGCAGG + Intergenic
985924447 5:3004880-3004902 TGAGCTGGTGGGGTGCTGGCAGG - Intergenic
987317816 5:16740395-16740417 TGGGAGTTGGGGGTGCAGGTAGG + Intronic
987457889 5:18169665-18169687 TGGGATGATGGGGAGCAAGATGG + Intergenic
992669934 5:79049126-79049148 TGGGGTGATGGGGTGCAGGAGGG - Intronic
994340075 5:98616961-98616983 TGGGAGGTGGGGGGGCGGGCGGG - Intergenic
997614497 5:135237182-135237204 TGGGTTGTTGGGGGACAGGCTGG + Intronic
998307737 5:141096141-141096163 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998310284 5:141123340-141123362 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998311442 5:141136776-141136798 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998312726 5:141151596-141151618 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998313418 5:141157343-141157365 TAGGAGGTTTGGGTGAAGGCGGG - Intergenic
998314903 5:141174180-141174202 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998315483 5:141179382-141179404 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998316578 5:141188663-141188685 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998317214 5:141193897-141193919 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998318845 5:141210252-141210274 TAGGAAGTTTGGGTGAAGGCGGG - Exonic
998319412 5:141215468-141215490 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998322628 5:141246923-141246945 TAGGAGGTTTGGGTGAAGGCGGG - Exonic
998813407 5:145988551-145988573 TGGGATGTTGGTTTGCATTCTGG - Intronic
999304040 5:150508360-150508382 AGGGATCTGGGGGTACAGGCTGG + Intronic
1001330024 5:170755222-170755244 TTGGATGTTGGGGAGCATCCTGG + Intergenic
1004235175 6:13868665-13868687 TGTGATGTGGGGGTGACGGCAGG + Intergenic
1004306110 6:14503083-14503105 TGGGTTCTTGGTGTGGAGGCTGG + Intergenic
1005414183 6:25583831-25583853 TGGGTTGTTGGGCGGGAGGCGGG - Intronic
1005897632 6:30191568-30191590 GGGGCCGGTGGGGTGCAGGCTGG + Intronic
1006295514 6:33168456-33168478 TGGGCTGTGTGGGTGGAGGCTGG - Intronic
1006336568 6:33424130-33424152 TGGCATGATGGGGTGAAGACTGG + Intronic
1006601873 6:35231681-35231703 TGGGGTCATGGGGTACAGGCAGG - Intronic
1006806315 6:36791970-36791992 GGGGGTGATGGAGTGCAGGCTGG - Intronic
1007622264 6:43222435-43222457 TGGGGTGGTGGGGTGGAGGGGGG + Intronic
1007998523 6:46334553-46334575 AGGGATGGTGGGGTGGGGGCAGG + Intronic
1008169609 6:48186908-48186930 TGGGATGCAGGGATGCAGACAGG - Intergenic
1008845411 6:55957392-55957414 TGGGGTGGTAGGGGGCAGGCAGG + Intergenic
1009883410 6:69597009-69597031 TGGGAATTTGGGGTGGAGGGGGG + Intergenic
1011529739 6:88308601-88308623 TAAGATATAGGGGTGCAGGCTGG - Intergenic
1012003322 6:93681647-93681669 TGGGAGGTTGTGGTGAAGGATGG - Intergenic
1012018074 6:93878502-93878524 TTAAATGTTGGGGTCCAGGCTGG + Intergenic
1013385483 6:109625667-109625689 TGGGTTGTGGGGGTGGAGGATGG - Intronic
1016121559 6:140348399-140348421 TGACATGTTGGGTAGCAGGCAGG + Intergenic
1017973765 6:159336226-159336248 TGGGGTGTTGGGGCCCAAGCAGG + Intergenic
1018089020 6:160329517-160329539 TGGGGTGGTGGGAGGCAGGCTGG + Intergenic
1018103284 6:160460127-160460149 TGGGATGGTGGGGAGGAGACTGG + Intergenic
1018752903 6:166822619-166822641 TGGGAGGTGGTGGGGCAGGCAGG - Intronic
1019407784 7:892847-892869 TGGGTAGTTGGGGTGCGTGCAGG + Intronic
1019746046 7:2700879-2700901 TGGGATGCCAGGGTGGAGGCAGG + Intronic
1019918735 7:4149739-4149761 AGGGGTGATGGGGGGCAGGCTGG + Intronic
1020211770 7:6163414-6163436 TGGGCTGTTGGGTTGGTGGCTGG - Exonic
1023350849 7:39318997-39319019 TTGGATGTGGTGGTGCATGCAGG + Intronic
1024465722 7:49709823-49709845 TGAGGTGTTGTGGTCCAGGCTGG - Intergenic
1025247550 7:57328643-57328665 TGGGATGCTGCCGGGCAGGCGGG + Intergenic
1026539472 7:71267853-71267875 TGGGAAGTGGGGGTGGGGGCAGG - Intronic
1026738804 7:72965735-72965757 TGGGGAGTGAGGGTGCAGGCGGG - Intronic
1026794692 7:73359022-73359044 CGGGGTGTCGGGGTGCAGGAGGG - Intergenic
1026794712 7:73359080-73359102 CGGGGTGTTGGGGTGCAGGAGGG - Intergenic
1026794732 7:73359138-73359160 CAGGGTGTTGGGGTGCAGGAGGG - Intergenic
1027104930 7:75399334-75399356 TGGGGAGTGAGGGTGCAGGCGGG + Intronic
1027266864 7:76499359-76499381 TGGCGTGGTGGGGTGGAGGCTGG - Intronic
1027464515 7:78498758-78498780 GAGGGTGTTGGGGAGCAGGCGGG + Intronic
1028199467 7:87944255-87944277 TAGGATGTTGGGGGTCAGGCTGG + Intronic
1028580642 7:92406274-92406296 AGGGATGGTGGGGGGCAGGTAGG + Intergenic
1029300578 7:99579895-99579917 GGAGATGTTGGGGTGCACACAGG + Intronic
1029745596 7:102514254-102514276 TGGGTTGATGGGATGCAAGCTGG - Intronic
1029763535 7:102613233-102613255 TGGGTTGATGGGATGCAAGCTGG - Intronic
1030050732 7:105534883-105534905 TGGGGTGTAGGGGTGGAGACAGG + Intronic
1030657733 7:112186163-112186185 TGGGATGCAGGGGTGCAAGGTGG - Intronic
1032051533 7:128653488-128653510 TGGGCTGCTGGGAGGCAGGCAGG - Intergenic
1032057990 7:128698780-128698802 TGCTGTGTTGGGGGGCAGGCTGG + Intergenic
1032082465 7:128866570-128866592 TGGGGCTTTGGGGTGCAGGGTGG - Intronic
1032446793 7:131991076-131991098 AGGGGTGGTGGGGAGCAGGCTGG + Intergenic
1032538587 7:132684952-132684974 TGGGATGTTGGGGTGAGGGCAGG + Intronic
1032847876 7:135767387-135767409 TGGGATGCTGTGGTCCAGCCAGG + Intergenic
1032917255 7:136505994-136506016 TGGCATGTTGGGATGCAGTAAGG - Intergenic
1035110272 7:156475930-156475952 TGGGGGGGTGGGGTGGAGGCAGG - Intergenic
1036200745 8:6769581-6769603 TGAGATGTTTGGATACAGGCAGG + Intergenic
1036232212 8:7008966-7008988 TGGGAAGTTGGGGTTCGGACAGG + Intronic
1037331451 8:17747660-17747682 TGGGATGTGGGGGGCAAGGCAGG - Intronic
1037696685 8:21229904-21229926 TGGGGTGTTGGAGGGAAGGCAGG - Intergenic
1037743198 8:21623413-21623435 TGGGAGGTGGGGGTGGAGGCTGG - Intergenic
1037816683 8:22116272-22116294 TGGGATGTGGGCCAGCAGGCTGG - Intronic
1038117080 8:24569105-24569127 AGGGATGTTTGGGTGCAGTGTGG - Intergenic
1038589581 8:28824434-28824456 TAGGTAGGTGGGGTGCAGGCAGG - Intronic
1038840505 8:31180539-31180561 CAGGATGTTAGGGTGCTGGCTGG + Intergenic
1040491323 8:47924985-47925007 TGGGATGTTGGGGTGCAGGCAGG - Intronic
1041562906 8:59240677-59240699 TGGGTTATAGGGGTGTAGGCTGG + Intergenic
1044348447 8:91134351-91134373 TGGGAGGTTGTGGTGGTGGCTGG + Intronic
1044394647 8:91696498-91696520 TGGGAAGCTGGGGAGGAGGCCGG - Intergenic
1044777211 8:95702644-95702666 TGGGGTGTTGGCAGGCAGGCTGG + Intergenic
1045189838 8:99871737-99871759 AGGGAGGTTGAGGAGCAGGCTGG + Intronic
1045348668 8:101317672-101317694 AGGGATGTTGGTGTGCAGAGTGG - Intergenic
1045355621 8:101386368-101386390 TGGGGTTGTGGGGTGGAGGCTGG + Intergenic
1046006677 8:108494580-108494602 TGGGGTGTGGGGGAGCAGGGAGG - Intergenic
1046041695 8:108913611-108913633 TTGCATGTGGGTGTGCAGGCAGG + Intergenic
1046254977 8:111684386-111684408 TGGAATGTTGGGACGGAGGCTGG - Intergenic
1047183969 8:122615284-122615306 TGGGAAGTGAGGGTGCTGGCAGG - Intergenic
1047731867 8:127735171-127735193 TGGGACGGTGGGGTACAGACTGG + Intergenic
1048190222 8:132281693-132281715 TGGGGTGTGGGGGTGCCGGTGGG - Intronic
1048924159 8:139255886-139255908 TTGGTTGTGGGGGTGCAGGGCGG - Intergenic
1049189501 8:141279049-141279071 GGGGGTCTTGGGGTGAAGGCTGG - Intronic
1049696616 8:143987028-143987050 TGAGATGGGGAGGTGCAGGCAGG - Intronic
1050310528 9:4348378-4348400 TGGGATGTGGAGGTGATGGCTGG - Intronic
1050356716 9:4790926-4790948 GGGGATGTTGGGGGGCAGGTGGG + Intergenic
1055787684 9:79887851-79887873 TTGGATGCTGGGTTGCAGGGTGG - Intergenic
1056374231 9:85991222-85991244 TGGGGTGTGGGAGTCCAGGCAGG + Intronic
1057194641 9:93110322-93110344 TGGGAGGTTGGGAAACAGGCTGG - Intronic
1057540655 9:95965749-95965771 TGGGAGGTGGAGGTGGAGGCAGG - Intronic
1057690040 9:97275847-97275869 TGTGATGTTAAGGTGCAGGATGG - Intergenic
1059407182 9:114108510-114108532 CGGGAGGTAGGGGTGCAGGGTGG - Intergenic
1061257793 9:129462707-129462729 GGGGATGCTGGGGTCCAGGAAGG + Intergenic
1061274452 9:129561454-129561476 GAGGATGATGGGGTGCAGGAAGG + Intergenic
1061300962 9:129704836-129704858 TGGGAACTTGGGGTGAGGGCTGG - Intronic
1061430570 9:130527870-130527892 TGGGATGTTGTGACTCAGGCAGG - Intergenic
1061905192 9:133693059-133693081 TGGGATATTGGGGGCCAGGGTGG - Intronic
1062028874 9:134353034-134353056 TGGCCTCTGGGGGTGCAGGCTGG + Intronic
1062355394 9:136159696-136159718 TGGGAAAGTGGGGGGCAGGCTGG + Intergenic
1062447778 9:136602818-136602840 TGGGATGCTGGGGAAAAGGCCGG - Intergenic
1062452710 9:136622255-136622277 TGGGGGGTTGGGGGACAGGCAGG - Intergenic
1203457906 Un_GL000220v1:7597-7619 TGGGATTTTAGTCTGCAGGCCGG + Intergenic
1186206421 X:7205229-7205251 CAGGATGTTGGTGTGTAGGCAGG - Intergenic
1186573753 X:10743877-10743899 AGGGTTGGTGGGGTGCAGGGCGG - Intronic
1186749339 X:12605627-12605649 AAGGATGTGGGGTTGCAGGCAGG - Intronic
1186788018 X:12971466-12971488 GGGGAACGTGGGGTGCAGGCAGG + Intergenic
1187717073 X:22113416-22113438 TGGAAGCTGGGGGTGCAGGCAGG - Intronic
1189808664 X:44761064-44761086 TGGGAGGTTGGGGAACAGCCAGG - Intergenic
1190752900 X:53377430-53377452 TTGGATGTGGGGGTGCAAGCAGG + Exonic
1191944278 X:66514597-66514619 TGGCATGTTGGGGGACAGGGGGG + Intergenic
1192583257 X:72301913-72301935 TGGGACTTTGGGGCCCAGGCGGG - Exonic
1192592202 X:72369643-72369665 TGGGATGCTCAGATGCAGGCTGG + Intronic
1193230360 X:79037649-79037671 TGGGAGGTTGGAGTGTAGGTGGG - Intergenic
1193600886 X:83507952-83507974 TGTGTTGTTGGGGGGCAGTCAGG - Intergenic
1193852256 X:86553125-86553147 TGAGATTTTGGGATGCGGGCTGG - Intronic
1194367229 X:93025903-93025925 TGGGATATTGGTGTGCAGTGGGG - Intergenic
1194562086 X:95434233-95434255 TGGGAAGTTGGGGAGTGGGCAGG + Intergenic
1194812692 X:98405330-98405352 TGGCATGTTGGGATGCAGGATGG + Intergenic
1200675443 Y:6142160-6142182 TGGGATATTGGTGTGCAGTGGGG - Intergenic
1201480924 Y:14438711-14438733 TGAGATTTTGGGATTCAGGCTGG - Intergenic
1201582613 Y:15526394-15526416 TGGGATGTGGGGATGCAGGAGGG - Intergenic
1202087256 Y:21151935-21151957 TGGGAGGGTGGTTTGCAGGCTGG + Intergenic