ID: 1040491324

View in Genome Browser
Species Human (GRCh38)
Location 8:47924989-47925011
Sequence TGTCTGGGATGTTGGGGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 1, 3: 28, 4: 312}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491324_1040491331 -5 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491331 8:47925007-47925029 AGACAGCTGTCCCAACACGTGGG No data
1040491324_1040491334 7 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491334 8:47925019-47925041 CAACACGTGGGTGCCTCATCTGG No data
1040491324_1040491335 12 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491335 8:47925024-47925046 CGTGGGTGCCTCATCTGGCTTGG No data
1040491324_1040491336 13 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491336 8:47925025-47925047 GTGGGTGCCTCATCTGGCTTGGG No data
1040491324_1040491338 29 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491338 8:47925041-47925063 GCTTGGGTAAACCCCATGCCAGG No data
1040491324_1040491330 -6 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491324 Original CRISPR TGTCTGGGATGTTGGGGTGC AGG (reversed) Intronic
900251936 1:1675413-1675435 GGCCTGGGATGGTGGGGCGCAGG + Intronic
900262347 1:1738270-1738292 GGCCTGGGATGGTGGGGCGCAGG + Intronic
900379273 1:2375807-2375829 TGGCTGGGATCTTGGGGTCTGGG - Intronic
900496032 1:2976581-2976603 TGGTTTGGATGGTGGGGTGCTGG + Intergenic
900496103 1:2976845-2976867 TGGCCTGGATGGTGGGGTGCTGG + Intergenic
900496175 1:2977109-2977131 TGGCCTGGATGGTGGGGTGCTGG + Intergenic
901230619 1:7640001-7640023 GGTCAGGGATGTTGGGCTGGAGG + Intronic
902512494 1:16974095-16974117 TGTTTGGGAAGTTGGGGAGATGG - Intergenic
902520529 1:17013149-17013171 TGGATAGGATGTGGGGGTGCAGG + Intergenic
902603064 1:17553109-17553131 AGTCTGGGATGCTGGGGTTCTGG - Intronic
903572503 1:24316901-24316923 TCTCTGGGTTGTTGGGATGAAGG + Intergenic
903650768 1:24920851-24920873 TGTCTGGGAGTTTGGGGGTCTGG + Intronic
904602124 1:31679521-31679543 TGTCTGTGTTTTTGGGGTGGGGG + Intronic
904810297 1:33159405-33159427 TGTCTTGGCTCTAGGGGTGCAGG - Intronic
904966371 1:34377497-34377519 CCTCTGAGATGTTGGGGGGCAGG + Intergenic
905662358 1:39737339-39737361 AGCCTGGGATGGTGGGGTGGAGG - Intronic
906308872 1:44738786-44738808 TGTCTGGGAGGTGGGGGGGGGGG + Intergenic
906601408 1:47132692-47132714 TGTCTGGGATGGTGGGTTAGGGG - Intergenic
907425129 1:54374730-54374752 TGTCTGGGTTCTTGGGGTCAGGG - Intronic
907857233 1:58315499-58315521 TGTGTTGGGTGCTGGGGTGCAGG + Intronic
907984489 1:59517182-59517204 TTTCAGGGCAGTTGGGGTGCTGG - Intronic
908168727 1:61484053-61484075 TATCTGCAATGCTGGGGTGCAGG + Intergenic
910125742 1:83840114-83840136 TGACTGGGAAGTTTGGGTACAGG + Intergenic
910826810 1:91417811-91417833 TGTCAGGGATGTTGGGAAGTGGG + Intergenic
915052421 1:153089532-153089554 TGTCTTGGTTGTTGGTGTACGGG - Intergenic
915094070 1:153446705-153446727 TGTCTGCTATGTTGGGGTCTGGG - Intergenic
915593222 1:156882258-156882280 TGTGTGGGGTGATGGGGGGCAGG + Intergenic
916802357 1:168226543-168226565 GGACTGGGGTGTTGGGGTGGCGG + Intronic
918115525 1:181493215-181493237 AATTTGGGATGTTGGGATGCTGG + Intronic
921017765 1:211207907-211207929 TGTCTGGGGTGCTGTGGTGGTGG - Intergenic
922356877 1:224784738-224784760 TGTCTGGCATGATGTGGTGTGGG + Intergenic
923848558 1:237765963-237765985 CGGCTGGGATGTTGCGGGGCTGG + Intronic
923954763 1:239003785-239003807 TGTGTGTGTTGTTGGGGTGGGGG - Intergenic
924744486 1:246818983-246819005 TGTTTGGGAAGTTGGGGAGATGG + Intergenic
1063091903 10:2872865-2872887 GGTTTGGGGTGTTGGGGGGCAGG + Intergenic
1063494182 10:6491473-6491495 TTTCTGGGATGTGTGGGTGGGGG + Intronic
1063574058 10:7245141-7245163 AGGCAGGGATGTTGGGGTCCTGG - Intronic
1064000011 10:11655648-11655670 TGTCTCGGATGTGATGGTGCTGG - Intergenic
1064302215 10:14132706-14132728 TGTCTGGGAAGTTGAGGATCAGG + Intronic
1067143085 10:43672483-43672505 TGTCTGGGAAGTCGGGGGGCAGG + Intergenic
1067439090 10:46298265-46298287 TGTCTGGGAAGTTGTGCTGTGGG + Intronic
1067557264 10:47281664-47281686 TGGCTCTGATGTGGGGGTGCAGG + Intergenic
1068008584 10:51420025-51420047 ATTCTGGGATGTTGGGGGGCAGG + Intronic
1070812382 10:79304961-79304983 TGTGAGGGATGCTGGGGTGGAGG + Intronic
1071473825 10:86007683-86007705 TGTCTGGTATGTGGGAGGGCTGG + Intronic
1071957741 10:90777909-90777931 TGTGTGGGATTTGGGGGTGGTGG - Intronic
1073290286 10:102410060-102410082 TTTCTGTGAGCTTGGGGTGCTGG - Intronic
1074971381 10:118542292-118542314 TCCCTGGGATGATGGGGTGCTGG - Intergenic
1076256708 10:129032321-129032343 TGTTTAAGATGCTGGGGTGCGGG + Intergenic
1076724397 10:132406809-132406831 AGTCTGGGGAGTTGGGGTGGGGG - Intronic
1076765914 10:132633009-132633031 TGCCTGGGGAGTTGGGGGGCTGG + Intronic
1076822547 10:132946675-132946697 GTGCTGGGATGCTGGGGTGCTGG - Intergenic
1076822584 10:132946811-132946833 ATGCTGGGATGCTGGGGTGCTGG - Intergenic
1076822601 10:132946883-132946905 GTGCTGGGATGCTGGGGTGCTGG - Intergenic
1076822618 10:132946939-132946961 ATGCTGGGATGCTGGGGTGCTGG - Intergenic
1077057554 11:602263-602285 TGTCTGTGTTGATGGGGTGGAGG + Intronic
1077862807 11:6198518-6198540 TTGCTGGGTTTTTGGGGTGCAGG - Intergenic
1081286133 11:41272230-41272252 TGTCTGTGAAGTTGGGGTGGGGG + Intronic
1082828318 11:57597644-57597666 GGTCAGGGAGGGTGGGGTGCGGG - Exonic
1083155781 11:60822014-60822036 TGGCTGGCAGGTTGGGGGGCGGG + Intergenic
1083612376 11:64010279-64010301 TGGCTGGCATGTTGGGGTGTTGG + Intronic
1083612408 11:64010427-64010449 TGGCTGACATGTTGGGGTGTTGG + Intronic
1083742809 11:64720152-64720174 TGTTTGGCATGGTGGGGTGAGGG - Intronic
1084909843 11:72379622-72379644 TGTCTGGGATGTTGTGTTGGTGG - Intronic
1085375789 11:76060052-76060074 TGTCTGGGTTGGTGGGGAGAGGG + Intronic
1087384486 11:97453265-97453287 TGTCTGGAGTTTTGTGGTGCGGG + Intergenic
1089039498 11:115433128-115433150 TGTGTGTGATGTTTGGGTGGGGG - Intronic
1089386108 11:118069111-118069133 AGTGTGGGATGCTGGGGTGCTGG - Intergenic
1090450242 11:126799886-126799908 TGGCTGGGATGGTGAGATGCTGG + Intronic
1092047169 12:5439900-5439922 TTGCTGGGAGGTTGGGGGGCAGG + Intronic
1094713284 12:32986474-32986496 TGTCAGGGGTGTTGGGGGCCGGG - Intergenic
1094841907 12:34345793-34345815 TCTCAGGGAAGTTGGGGTCCCGG - Intergenic
1095954466 12:47798386-47798408 TGTGGGGGATGTGGGGGTGGGGG - Intronic
1096309254 12:50505501-50505523 TGTCTCGGGTTTTGGGGGGCAGG - Intronic
1099124361 12:78733820-78733842 TATATGGGATGTGAGGGTGCTGG + Intergenic
1101194362 12:102367844-102367866 TTTCTTGGATGTTGGGGGTCAGG - Intergenic
1101563208 12:105879921-105879943 CGTCAGGGAAGTTGGGGTGTGGG + Intergenic
1102036423 12:109772941-109772963 TGTCTGGGCAGTTGGGGCTCTGG - Intergenic
1102585699 12:113921399-113921421 TGTATGAGATGCTGGGGTGTGGG - Intronic
1103516622 12:121512580-121512602 CGTCTGAGCTGTTGTGGTGCAGG - Intronic
1103941959 12:124506078-124506100 TGCCTGGGGTGAAGGGGTGCAGG - Intronic
1104341149 12:127950122-127950144 TGTCTGGGATGCTGAAGTGATGG + Intergenic
1105009775 12:132747837-132747859 TGTCGGGGGTGTTGAGGTACAGG + Exonic
1107495913 13:40925536-40925558 TGTCAGGGAGGGTGGGGAGCAGG + Intergenic
1108356194 13:49630627-49630649 TCTCTGGGACGTTGGGGGGCAGG + Exonic
1108453548 13:50590443-50590465 TGTGTGGGCTCTTGGGGTTCTGG + Intronic
1114268070 14:21084337-21084359 TGTGTTGGGTGTTGAGGTGCAGG - Intronic
1114943702 14:27650437-27650459 TGGCAGGGATGTTAGAGTGCAGG + Intergenic
1117361224 14:54976270-54976292 TGTCACGCAGGTTGGGGTGCAGG + Intronic
1117979945 14:61332878-61332900 CGTCTGTGATGTTGGAGGGCTGG + Intronic
1118251600 14:64167001-64167023 TTCCTGGGCTGTTTGGGTGCTGG + Intronic
1119180227 14:72600369-72600391 CGTCAGGGAAGTAGGGGTGCTGG - Intergenic
1119263343 14:73250955-73250977 TGTCTGCGGTGTGGGGGTGACGG + Exonic
1120140064 14:80920270-80920292 TGTCTGGGTTGTAGTGGTGTTGG - Intronic
1120907533 14:89633399-89633421 TGTCTGGGATGCTGCTGAGCGGG - Intronic
1121499880 14:94426372-94426394 TCTCTGTGATGTTTGGGTACAGG + Intergenic
1121509313 14:94500595-94500617 TTGTTGGAATGTTGGGGTGCTGG + Intronic
1122142106 14:99668658-99668680 GGGCTGGGGTGTGGGGGTGCAGG - Intronic
1122155381 14:99747411-99747433 TGTCTGGCCTGATGGGGGGCAGG + Intronic
1122266756 14:100550249-100550271 TGGCTGGGATGCTGGGCTGAGGG + Intronic
1122771529 14:104099938-104099960 TGTCTGGGCGGGTGGGGTGGAGG + Intronic
1122982839 14:105199361-105199383 GGAGTGGGATGTTCGGGTGCTGG - Intergenic
1124625268 15:31304169-31304191 TGGCTGGGGGGTGGGGGTGCAGG - Intergenic
1125600344 15:40912218-40912240 GGTCTGGGATGTGGGGCTTCTGG + Intergenic
1126691151 15:51289852-51289874 TGTGTAGGATGTTGGGGAGCTGG - Intronic
1128374919 15:67067363-67067385 TGGCTGGGAACTGGGGGTGCGGG + Intronic
1128379036 15:67098283-67098305 TGTCTTGGGTGGTGGGGTGGGGG - Intronic
1129163035 15:73757884-73757906 TGCCTGGGGTGTGGGGGTGAGGG + Intergenic
1129342876 15:74897594-74897616 TGTCTGGGTTGTGGGTGTGCTGG - Exonic
1129450870 15:75650533-75650555 TGTCAGGGAAGTTGGAGAGCAGG - Exonic
1129455349 15:75673725-75673747 TGTTTCAGATGTTGGGATGCAGG + Intergenic
1129521752 15:76190586-76190608 TGGATGGGATGTTGGGGTGGGGG + Intronic
1130745391 15:86648187-86648209 TGTTTGGGATGTTGTGGGGGAGG + Intronic
1131030916 15:89185376-89185398 TGACTGCGGTGTGGGGGTGCAGG - Intronic
1131315389 15:91331830-91331852 TGCCTGTGATGTAGGGGTACAGG + Intergenic
1132111117 15:99103035-99103057 CCTCTGGGACATTGGGGTGCGGG - Intronic
1133301227 16:4783977-4783999 TGTCTGGGATGTGGCGCTGGCGG + Exonic
1133488252 16:6241148-6241170 TGGCAGGGGCGTTGGGGTGCTGG - Intronic
1134100120 16:11446138-11446160 TGTGTGTGAGGTTGGGGGGCGGG + Intronic
1134293125 16:12919977-12919999 AGTCAGGGAAGTCGGGGTGCAGG - Intronic
1136873196 16:33826780-33826802 TGTCTGGGATGGGTGAGTGCTGG - Intergenic
1137455264 16:48613114-48613136 TTTCTGAGAAGGTGGGGTGCTGG + Intronic
1137728224 16:50671077-50671099 TGTGTGGGGTGTTGGGGGGGTGG - Intronic
1137751436 16:50863765-50863787 TGTCTGTGCTGTTGCGATGCAGG + Intergenic
1137921928 16:52498545-52498567 TGACAGGGATGTTGGGAGGCAGG - Intronic
1138546321 16:57721980-57722002 TGTGTGGGATGATGGCGTGTAGG + Intronic
1138604669 16:58081232-58081254 TGTCTCTGTTGTTGGGGTCCAGG + Intergenic
1138701671 16:58869607-58869629 TGTCTGGGGGGAGGGGGTGCCGG + Intergenic
1139367068 16:66440033-66440055 TTGATGGGATGTTGGGGTGCGGG - Intronic
1140193284 16:72836336-72836358 TGTCTGGGATGTTGCAGAGTAGG - Intronic
1140474918 16:75235017-75235039 TGTCAGTGGGGTTGGGGTGCAGG + Exonic
1140987200 16:80169222-80169244 TCTTTGGGAAGTTGGGGTGGGGG + Intergenic
1141254892 16:82391831-82391853 TGCCTGGGATTCAGGGGTGCTGG + Intergenic
1203098976 16_KI270728v1_random:1289275-1289297 TGTCTGGGATGGGTGAGTGCTGG + Intergenic
1142546016 17:703397-703419 TGTCCGGTGTCTTGGGGTGCAGG - Intronic
1143022133 17:3922218-3922240 TGGCTGGCATGTTGGTGTGGTGG - Intergenic
1143596074 17:7915059-7915081 TCTCTGGCATGTAAGGGTGCTGG - Intergenic
1144729385 17:17517895-17517917 GGTCTGGGTGGGTGGGGTGCAGG - Intronic
1146365267 17:32219741-32219763 TGTCTGGGATGTTGGCTTTCTGG - Intronic
1148001310 17:44389128-44389150 TGTCAAGAATGTTGGGGTCCAGG - Intronic
1148416650 17:47511721-47511743 AGTCTGGGGGGTTGGGGTGGGGG + Intergenic
1148755279 17:49969865-49969887 TCCCTGGGATGTGGGGGTGGGGG + Intronic
1148870739 17:50657604-50657626 TGGCTGTGATGTTGGGCTGGTGG + Intronic
1148883580 17:50753906-50753928 TACCTGGGATGTGGGGGTGGTGG + Exonic
1151524268 17:74653237-74653259 TGGGTGGGATGTAGGGGTGGTGG - Intergenic
1151731652 17:75914930-75914952 GCTCTGGGATGTGGGGGTGAAGG + Exonic
1152553890 17:81043485-81043507 TGGCTGTGAAGCTGGGGTGCTGG + Intronic
1155043483 18:22084324-22084346 TGCCTGGGATGTGGGCGTGATGG + Intergenic
1156755219 18:40515035-40515057 TGTAAGGGCTTTTGGGGTGCTGG + Intergenic
1160150007 18:76391603-76391625 TGTCTGGGATGGGGCTGTGCAGG - Intronic
1160394815 18:78563815-78563837 GGTGTGGGATGTGGGGGTGTGGG - Intergenic
1160394841 18:78563878-78563900 GGTGTGGGATGTGGGGGTGTGGG - Intergenic
1160394876 18:78563963-78563985 GGTGTGGGATGTGGGGGTGTGGG - Intergenic
1160468780 18:79107467-79107489 TGAGTGGGATGTTGGGAGGCAGG + Intronic
1161021808 19:2014547-2014569 TGTCTGGGGACCTGGGGTGCAGG + Intronic
1161297333 19:3526578-3526600 AAACTGGGATGTGGGGGTGCGGG + Intronic
1161568974 19:5019666-5019688 TGGCGTGGATGTTGGTGTGCAGG + Intronic
1162087348 19:8256746-8256768 TGGCCGGGATGCTGGGGTGCTGG + Intronic
1164678268 19:30117551-30117573 TGGCTTGGATGTGGGGGTGCTGG + Intergenic
1165021204 19:32925862-32925884 GGGCTGAGATCTTGGGGTGCAGG - Intronic
1165086011 19:33347913-33347935 TCTCTGGGATGCTGGGGACCGGG + Intergenic
1165706952 19:37982989-37983011 TGGCTGGGATGTCGGGGTAGAGG - Intronic
1166790321 19:45395459-45395481 TGTTGGGGATGCTGGGGGGCTGG + Exonic
1167115553 19:47487388-47487410 TCTCTGGGTTCTTGGGGTCCAGG - Intergenic
1167368369 19:49066186-49066208 TGGCTGGGATGGTGAGGAGCAGG - Intergenic
1167504732 19:49865277-49865299 TGGCTGGGATTCTGGTGTGCGGG + Exonic
1167848964 19:52187786-52187808 TGCTTGGGATGTTGGGCTGGTGG - Intergenic
1167932011 19:52873702-52873724 TGTCAGTGATGTTGGGCAGCAGG - Intronic
1167942044 19:52955738-52955760 TGTCAGTGATGTTGGGCAGCAGG - Intronic
1168322079 19:55516905-55516927 TGCGTGGGGTGCTGGGGTGCGGG - Intronic
1168543529 19:57231764-57231786 TGGCTGGGCTGCTGGGCTGCTGG - Exonic
925020406 2:563617-563639 TGCCTGGCATGTTGGGGTCATGG - Intergenic
925281903 2:2690832-2690854 TGTGTGGGAGGTTAGGGTGTGGG - Intergenic
925286659 2:2720867-2720889 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286677 2:2720935-2720957 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286704 2:2721037-2721059 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286781 2:2721343-2721365 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925286872 2:2721683-2721705 TGGCTGGGGTGTGGAGGTGCAGG - Intergenic
925886918 2:8401366-8401388 TGCCTGGGCAGTTGGGGTGAGGG - Intergenic
928721878 2:34130452-34130474 TGTGTGGGATCTTGTGGTGGGGG + Intergenic
928890035 2:36193840-36193862 TATGTGGGATGCTGGGGTGGAGG + Intergenic
929125965 2:38523055-38523077 TTTCTGGGAGGATGTGGTGCAGG + Intergenic
929570947 2:43022451-43022473 TGTCTGGGAGGTTGGGGGGGGGG + Intergenic
931528473 2:63185914-63185936 TGTTTGGGAGGTGGGGGGGCCGG - Intronic
931566680 2:63622144-63622166 TGTCTGGGTTGCTGTGGTGGTGG + Intronic
931919295 2:66995688-66995710 TGTCCGGGATGTTGAAGTCCTGG - Intergenic
932582501 2:73000908-73000930 TGTCTGGGAACTGGAGGTGCAGG - Intronic
935156363 2:100487017-100487039 TGTCTGTGATGCTAGGGAGCTGG + Intergenic
936506957 2:113115666-113115688 TCTCTGGGATGTTGGGCTCCAGG + Intronic
937044472 2:118843898-118843920 TGTGTGGGAGGGAGGGGTGCGGG - Intronic
937080094 2:119134668-119134690 TGTTTGTGAAATTGGGGTGCAGG - Intergenic
937440965 2:121915676-121915698 TTTCTTGGAAGCTGGGGTGCAGG + Intergenic
939220534 2:139296000-139296022 TCTCTGGGATGGTGGGAGGCAGG + Intergenic
942417923 2:175778160-175778182 GGCCTGGGATGTTGGGGGGCGGG - Intergenic
943646751 2:190414111-190414133 TGTCTGGGGGGTTGGGTGGCAGG + Intronic
947597263 2:231420994-231421016 TGTCCAGGCTGCTGGGGTGCTGG - Intergenic
947727737 2:232410325-232410347 TGGCTGGGAGGGTGGGTTGCAGG - Exonic
948227548 2:236323269-236323291 GCTCTGGGATGTTAGGGTGGGGG + Intergenic
1169415427 20:5412081-5412103 TGTCTGGGAAGTGGGAGTGGGGG - Intergenic
1172673317 20:36649250-36649272 TGTCTGGGGTGTTGGAGAACTGG + Intergenic
1174173072 20:48628945-48628967 TGTCTGGGGAGTGGGGGTGAGGG + Intronic
1174353453 20:49983543-49983565 GGGCTGGGATGATGGGGTTCTGG + Intronic
1175496178 20:59415822-59415844 TGGCTGGGATGTTGGGGTGATGG + Intergenic
1175701684 20:61142720-61142742 AATCAGGGATGGTGGGGTGCTGG + Intergenic
1175895992 20:62335803-62335825 TGGAGGGAATGTTGGGGTGCAGG - Intronic
1175896013 20:62335863-62335885 TGGAGGGAATGTTGGGGTGCAGG - Intronic
1175896094 20:62336140-62336162 TGAAGGGAATGTTGGGGTGCGGG - Intronic
1178116016 21:29417509-29417531 TCTCTGGGATGTAGCAGTGCTGG + Intronic
1178760871 21:35401615-35401637 AGTCGGTGATGTTGGGGTGGGGG - Intronic
1179050949 21:37888188-37888210 TGCGTGTGATTTTGGGGTGCTGG + Intronic
1180762346 22:18220009-18220031 GGGCTGGGAAGCTGGGGTGCCGG + Intergenic
1180773322 22:18404599-18404621 GGGCTGGGAAGCTGGGGTGCCGG - Intergenic
1180804675 22:18654148-18654170 GGGCTGGGAAGCTGGGGTGCCGG - Intergenic
1180806073 22:18715262-18715284 GGGCTGGGAAGCTGGGGTGCCGG + Intergenic
1181025387 22:20124605-20124627 TGCCTGGGGAGTTGGGGTGGAGG + Intronic
1181192418 22:21151532-21151554 GGGCTGGGAAGCTGGGGTGCCGG - Intergenic
1181217021 22:21341043-21341065 GGGCTGGGAAGCTGGGGTGCCGG + Intergenic
1181307734 22:21926629-21926651 TGTCAGGGATGCTGTTGTGCAGG - Intronic
1181338164 22:22157045-22157067 TGTCAGGGAGGATGGGCTGCTGG - Intergenic
1182279153 22:29208217-29208239 TGCCTGGGGTGCTGGGGTGTGGG - Intronic
1182858790 22:33541035-33541057 TGGCTGGGGTGGTGGGTTGCGGG + Intronic
1182888767 22:33798693-33798715 TGTCAAGGAGCTTGGGGTGCAGG - Intronic
1184109032 22:42384440-42384462 ATTCTGGCATGTTGGGGTGAGGG - Exonic
1184334809 22:43846909-43846931 TGTCTGGGTCGTTGGCCTGCGGG - Intronic
1184920951 22:47605594-47605616 TATCTGCGTTGTTGGGATGCAGG - Intergenic
1185015346 22:48339541-48339563 GGTCTGGGTTGCTGGAGTGCAGG - Intergenic
1203235152 22_KI270731v1_random:145581-145603 GGGCTGGGAAGCTGGGGTGCCGG - Intergenic
949483446 3:4515103-4515125 TGTCTGGGTTGTTGGAGGGGAGG + Intronic
949716229 3:6934659-6934681 TGACTCGGTTGTTGTGGTGCAGG + Intronic
950359998 3:12443442-12443464 TGGCTGGGATATGAGGGTGCTGG + Intergenic
952381899 3:32811862-32811884 TGTGTGAGATGTTGAGGTCCAGG + Intergenic
952687011 3:36161827-36161849 GCTCTTGTATGTTGGGGTGCTGG - Intergenic
954425260 3:50439768-50439790 TGTCAGGGATGTTGGGTGGGTGG + Intronic
958086394 3:88813547-88813569 TGTGAGGGATATTGGGGTGATGG + Intergenic
961626220 3:128265566-128265588 TGCCTGGAATGCTGGGGTCCAGG + Intronic
961837860 3:129679042-129679064 TTTATGGGATGTAGTGGTGCAGG - Intronic
962024190 3:131529687-131529709 TGTCAGGGATGGTGGGGTGGGGG - Intergenic
962933523 3:140059043-140059065 AGTATGTGATGTTGGGGTGTGGG + Intronic
964812183 3:160677529-160677551 AGTCTGGGATGTTGGAGGACAGG + Exonic
967572879 3:191051618-191051640 TGTCTGCAAGGTTGGGGTGGGGG + Intergenic
968623028 4:1612547-1612569 TGTGTGTGATGTGTGGGTGCAGG - Intergenic
968662058 4:1802710-1802732 GGGCTGGGTTGTTGGGGTGGAGG + Intronic
968709527 4:2102768-2102790 TCTTTGGGATGTTAGGGTGTAGG - Intronic
968800680 4:2741627-2741649 TGTGTTGGAAGCTGGGGTGCAGG - Intronic
969037777 4:4269231-4269253 TGTCTGTGCTGTTGGTGTTCAGG - Intronic
971015841 4:22487954-22487976 GGTGCCGGATGTTGGGGTGCCGG + Intronic
971493200 4:27236388-27236410 AATCTGGGATGTTGGCTTGCTGG - Intergenic
972781842 4:42293010-42293032 TGTTAGTGATGTTGGGGAGCCGG + Intergenic
973846223 4:54915888-54915910 TGTTGGGGATGTGGGGGTGTGGG - Intergenic
974008624 4:56586118-56586140 TGTCTGAAATGGTGGGGGGCTGG + Intronic
977207931 4:94184443-94184465 TCTCTGGGATGTAGGAGTCCAGG + Intergenic
977260408 4:94790423-94790445 TGGGTGGGGTGTTGGGGTTCTGG + Intronic
977855673 4:101888388-101888410 TGTGTGGGAGGTAGGGGTACTGG - Intronic
981128575 4:141133222-141133244 AGTCTGGGGTGCTGCGGTGCGGG + Intronic
982978011 4:162091463-162091485 TGTCTGGGGTTTTGGGGTGGGGG + Intronic
984824667 4:183913765-183913787 TGTCTGGAGTGTGGGGGTGGAGG + Intronic
985523520 5:390279-390301 TGTCTGAGATGTTTTGATGCAGG - Intronic
985676710 5:1235156-1235178 GGTCTGGGATGGTGGGTGGCAGG + Intronic
987746154 5:21974731-21974753 TGTCTGGCATTTTGTGGTGTAGG + Intronic
988495117 5:31738329-31738351 TGTCTGGCTTGTGTGGGTGCTGG + Intronic
992667574 5:79026158-79026180 TGTCTTGGACTTTGGGGAGCCGG - Intronic
997614496 5:135237178-135237200 TGTCTGGGTTGTTGGGGGACAGG + Intronic
997742978 5:136273917-136273939 TGACTGGGATGTGGGGATGGTGG + Intronic
998928818 5:147157685-147157707 TGTCTGGGAGGTTGGGGTTTAGG + Intergenic
999048837 5:148499750-148499772 TGTCTGGGTTATGGGGGTGGAGG + Intronic
1000343112 5:160292934-160292956 TGTCTGTAATGTAGGGATGCTGG - Intronic
1000618643 5:163458551-163458573 TGTCTCCCATGCTGGGGTGCAGG - Intronic
1001853903 5:174994347-174994369 GGTGTTGGAAGTTGGGGTGCTGG + Intergenic
1001919200 5:175587304-175587326 TGCCTGTGATGTGGGGGTGGGGG + Intergenic
1002159442 5:177306579-177306601 TGTCTGGGGTGCTGTGGTGGTGG - Exonic
1002580713 5:180208310-180208332 GAGCTGGGAAGTTGGGGTGCTGG - Intronic
1005297417 6:24439958-24439980 TGTTTGGGATGCAGGGGTGGTGG + Intronic
1005401168 6:25436201-25436223 TGTGTGGGTTGTTGGGATGGAGG + Intronic
1005632281 6:27719559-27719581 GGTTGGGGATGTTGGGGCGCAGG - Intergenic
1006517838 6:34554633-34554655 TGTCTGTGAGTTTGGGGTGGTGG + Intronic
1007106919 6:39289837-39289859 TGTCTGGGATGTGGGTATGATGG + Intergenic
1007787510 6:44289657-44289679 TGTCTGGAATGCTGGGAGGCTGG - Intronic
1011400608 6:86957576-86957598 TGACTGAGATGTTGGGGCTCAGG - Intronic
1011902347 6:92314464-92314486 TGTGTGGGTTGTGGGGGTGTGGG - Intergenic
1012690132 6:102300063-102300085 TGTCTGGGCTGTTGGGACCCAGG - Intergenic
1014874832 6:126644308-126644330 TGTCTGGGGTGCTGTGGTGGTGG - Intergenic
1016999617 6:149987006-149987028 TGTCAGGGAGGTGGGGGTGGGGG + Intergenic
1017007006 6:150035356-150035378 TGTCAGGGAGGTAGGGGTGAGGG - Intergenic
1019134811 6:169901410-169901432 TGACAGTGATGTTGGGGTGATGG + Intergenic
1019146192 6:169976899-169976921 TGTTTGGGGTGTGGTGGTGCCGG + Intergenic
1019277217 7:182146-182168 AGTGTGGGATGCTGGGTTGCCGG - Intergenic
1019739193 7:2664353-2664375 TGTCTGGGGTTCTGGGGTCCAGG - Exonic
1020005886 7:4783619-4783641 TGCCTGGGTTGTTGGGATGCTGG - Intronic
1022540925 7:31134858-31134880 TGTTTCGTATGGTGGGGTGCCGG + Intergenic
1022649699 7:32263108-32263130 TAGCAGGGATGTTGGGGTGATGG - Intronic
1024094728 7:45974621-45974643 TGGCTGGTATGTGGGGGTGTAGG - Intergenic
1024867320 7:53918972-53918994 TCTCTGGGATGTAGGAGTGTGGG + Intergenic
1026794716 7:73359084-73359106 AGCCCGGGGTGTTGGGGTGCAGG - Intergenic
1027318431 7:76998207-76998229 TGTGTGGGATGTGGAGGTGTGGG + Intergenic
1028075874 7:86514711-86514733 TGTCTGGGAAGTGGAGGTACTGG + Intergenic
1028579974 7:92398559-92398581 TGTCATTGATGTTGGGGTCCTGG - Exonic
1029994680 7:104995823-104995845 TGGATGGGATGTGGGGGTGGTGG - Intergenic
1030334873 7:108315005-108315027 TGACTGGGTTGTTGGGGGGGTGG - Intronic
1031974043 7:128082759-128082781 TGGCGGGGATTTTGGGGTGGTGG - Intronic
1032013398 7:128360898-128360920 TGTGTGTGATGTAAGGGTGCCGG - Intronic
1032096418 7:128940509-128940531 TGTCTGCAAGTTTGGGGTGCGGG + Intronic
1032201359 7:129825309-129825331 AGGGTGGGATGGTGGGGTGCTGG - Intergenic
1032538586 7:132684948-132684970 GGTGTGGGATGTTGGGGTGAGGG + Intronic
1035440290 7:158891535-158891557 TGTCTGGGTTGTGGGGGTCAAGG + Intronic
1036647978 8:10623938-10623960 TGCCAGGGATGTGGAGGTGCTGG - Intronic
1038806909 8:30802404-30802426 TGTCTGGGAGGTAGGAGGGCAGG + Intronic
1040491324 8:47924989-47925011 TGTCTGGGATGTTGGGGTGCAGG - Intronic
1042014704 8:64295665-64295687 TATCTGGGAAGTTAGGGAGCAGG - Intergenic
1042688989 8:71475316-71475338 TGTCTGGGATGTGGGACTGCAGG + Intronic
1044604393 8:94036260-94036282 TAGCTGGGATGATGGGGAGCTGG - Intergenic
1047640163 8:126810632-126810654 TGAATGGGATGGTGGGGTGGGGG - Intergenic
1048190224 8:132281697-132281719 TGGTTGGGGTGTGGGGGTGCCGG - Intronic
1049335438 8:142082104-142082126 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1049335465 8:142082241-142082263 TGTCTGGGATGTGTGTGTGGGGG - Intergenic
1049335484 8:142082326-142082348 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1049335550 8:142082722-142082744 TGTCTGGGATGTGTGTGTGTGGG - Intergenic
1052680115 9:31680393-31680415 TGTCTGAGATTCTGGGGTTCTGG - Intergenic
1053135930 9:35650289-35650311 TGGCTGGGATGGGGGCGTGCAGG - Intronic
1056305901 9:85289970-85289992 TGTGGGGGATGTGGGGGTGGGGG + Intergenic
1056382072 9:86064694-86064716 AGAGTGTGATGTTGGGGTGCAGG - Intronic
1056779903 9:89541572-89541594 TGTCTGGGAAGATGGGCTCCAGG - Intergenic
1057223332 9:93269696-93269718 TTCCTGTGATGTAGGGGTGCAGG + Intronic
1057298962 9:93865565-93865587 TCTCTGGGACGTTGTGGGGCCGG - Intergenic
1060575373 9:124687426-124687448 TGTTTGGGATGTTGGGGGCATGG - Intronic
1060983512 9:127807141-127807163 TCTCTGGGGAGATGGGGTGCTGG - Intronic
1061213430 9:129206515-129206537 TGACTGAGAGGGTGGGGTGCTGG - Intergenic
1061391193 9:130318076-130318098 TTTCTGGGATTCTGGGATGCTGG + Intronic
1187578019 X:20578591-20578613 TGGCTGGGGTGTGGGGGTGAGGG - Intergenic
1189006446 X:36999876-36999898 TTTCTGGCATGTTGGGCTTCTGG - Intergenic
1190653501 X:52590915-52590937 TGTGTGGGATGTTTGGGAGCTGG - Intergenic
1190680198 X:52820205-52820227 TGTGTGAGATGTTCGGGAGCTGG - Intergenic
1190684019 X:52854142-52854164 TGCCTGGGATGTTCAGGAGCTGG + Intergenic
1190737690 X:53266647-53266669 TGCCTGGGAAGTGGGAGTGCGGG + Intronic
1191823629 X:65339879-65339901 TTTCTGGCATGGTGGGGGGCTGG + Intergenic
1192491263 X:71578969-71578991 TGTCGGGGAAGTGGGGGTGCTGG + Intronic
1192522254 X:71813267-71813289 TGTTTGGCATGTGGGTGTGCTGG + Intergenic
1193426696 X:81348532-81348554 AGTCTAGGATGATGGGGTTCAGG - Intergenic
1194556407 X:95366114-95366136 TGTCTGGGGTGATGGGGTTAGGG + Intergenic
1196379060 X:115069181-115069203 CGCCAGGGAGGTTGGGGTGCTGG - Intergenic
1196432817 X:115645360-115645382 TGTTTGGGAGGTTGAGGTGGGGG + Intronic
1198214289 X:134542872-134542894 TGAGTGGGATGTAGGGGGGCAGG + Intergenic
1199872755 X:151913320-151913342 TGTTTGGGAGGATGGGGAGCTGG - Intronic