ID: 1040491330

View in Genome Browser
Species Human (GRCh38)
Location 8:47925006-47925028
Sequence CAGACAGCTGTCCCAACACG TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040491318_1040491330 17 Left 1040491318 8:47924966-47924988 CCTCCATCGCCCTTCTCACCCTG 0: 1
1: 1
2: 3
3: 43
4: 397
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491319_1040491330 14 Left 1040491319 8:47924969-47924991 CCATCGCCCTTCTCACCCTGCCT 0: 1
1: 1
2: 3
3: 56
4: 682
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491323_1040491330 -2 Left 1040491323 8:47924985-47925007 CCTGCCTGCACCCCAACATCCCA 0: 1
1: 0
2: 3
3: 46
4: 430
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491324_1040491330 -6 Left 1040491324 8:47924989-47925011 CCTGCACCCCAACATCCCAGACA 0: 1
1: 0
2: 1
3: 28
4: 312
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491320_1040491330 8 Left 1040491320 8:47924975-47924997 CCCTTCTCACCCTGCCTGCACCC 0: 1
1: 0
2: 11
3: 69
4: 628
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491322_1040491330 -1 Left 1040491322 8:47924984-47925006 CCCTGCCTGCACCCCAACATCCC 0: 1
1: 0
2: 4
3: 60
4: 502
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491321_1040491330 7 Left 1040491321 8:47924976-47924998 CCTTCTCACCCTGCCTGCACCCC 0: 1
1: 1
2: 3
3: 102
4: 950
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data
1040491317_1040491330 28 Left 1040491317 8:47924955-47924977 CCAAACTACTACCTCCATCGCCC 0: 1
1: 0
2: 0
3: 7
4: 120
Right 1040491330 8:47925006-47925028 CAGACAGCTGTCCCAACACGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040491330 Original CRISPR CAGACAGCTGTCCCAACACG TGG Intronic
No off target data available for this crispr