ID: 1040500152

View in Genome Browser
Species Human (GRCh38)
Location 8:47998431-47998453
Sequence CAGAGGAACCAGAAGCCTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040500146_1040500152 1 Left 1040500146 8:47998407-47998429 CCGCCGTGTCAGGTGTCCCTGAC No data
Right 1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG No data
1040500147_1040500152 -2 Left 1040500147 8:47998410-47998432 CCGTGTCAGGTGTCCCTGACACA No data
Right 1040500152 8:47998431-47998453 CAGAGGAACCAGAAGCCTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040500152 Original CRISPR CAGAGGAACCAGAAGCCTGG AGG Intergenic
No off target data available for this crispr