ID: 1040501441

View in Genome Browser
Species Human (GRCh38)
Location 8:48008628-48008650
Sequence GGCCGCCGGGGCCTCGGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 532
Summary {0: 1, 1: 0, 2: 5, 3: 61, 4: 465}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040501441_1040501454 22 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501454 8:48008673-48008695 GCGCGTCGGCCGCGCGCCGGCGG No data
1040501441_1040501448 -10 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501448 8:48008641-48008663 CCCGGCGGCCGTCGGGTTGGCGG 0: 1
1: 0
2: 0
3: 12
4: 134
1040501441_1040501459 30 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501459 8:48008681-48008703 GCCGCGCGCCGGCGGGCTGGGGG No data
1040501441_1040501457 28 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501457 8:48008679-48008701 CGGCCGCGCGCCGGCGGGCTGGG No data
1040501441_1040501458 29 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501458 8:48008680-48008702 GGCCGCGCGCCGGCGGGCTGGGG No data
1040501441_1040501453 19 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501453 8:48008670-48008692 CTCGCGCGTCGGCCGCGCGCCGG 0: 1
1: 0
2: 2
3: 16
4: 80
1040501441_1040501450 -9 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501450 8:48008642-48008664 CCGGCGGCCGTCGGGTTGGCGGG 0: 1
1: 0
2: 0
3: 11
4: 105
1040501441_1040501455 23 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501455 8:48008674-48008696 CGCGTCGGCCGCGCGCCGGCGGG No data
1040501441_1040501456 27 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501456 8:48008678-48008700 TCGGCCGCGCGCCGGCGGGCTGG No data
1040501441_1040501452 8 Left 1040501441 8:48008628-48008650 CCGGCGCCGAGGCCCCGGCGGCC 0: 1
1: 0
2: 5
3: 61
4: 465
Right 1040501452 8:48008659-48008681 GGCGGGTCGTGCTCGCGCGTCGG 0: 1
1: 0
2: 0
3: 1
4: 25

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040501441 Original CRISPR GGCCGCCGGGGCCTCGGCGC CGG (reversed) Intronic
900092019 1:924719-924741 GGCCACCGCGGCCGCGGCCCCGG + Intergenic
900109400 1:999215-999237 GGGCGCTGGGGCCTCTGCGGGGG + Exonic
900121532 1:1050454-1050476 GGCCGCTGGGGCCTCGTGCCAGG - Exonic
900176556 1:1293795-1293817 CGCGGCCGGGCCCTCGGGGCTGG - Intronic
900226637 1:1536194-1536216 GGCCTCCGCGGCCCCGGGGCGGG - Intronic
900269170 1:1778413-1778435 GGCCGCCCGGACCCCGGCGCCGG + Intronic
900283870 1:1890376-1890398 GGCGGCCGGAGCCCCCGCGCGGG - Intronic
900324140 1:2099603-2099625 GGCAGCCGGGGGCACGGCACAGG + Intronic
900324271 1:2100372-2100394 GGCAGCTGGGGCCTCTGGGCAGG - Intronic
900344481 1:2204590-2204612 GGCTCCCGGGGGCTCGGCGGCGG - Intronic
900438296 1:2641601-2641623 GGCCGCAGGGGCCTTTGCCCAGG - Exonic
900464069 1:2815579-2815601 GGCAGCCGGGGCTTGGGGGCAGG + Intergenic
900511293 1:3062311-3062333 AGCCCCCGGGGCATGGGCGCCGG + Intergenic
900512971 1:3069047-3069069 CGCCGCCGCCGCCTCGGCGCGGG - Intergenic
900581683 1:3412727-3412749 GGCTGCTGGGGCATCCGCGCCGG - Exonic
901251705 1:7784263-7784285 GGCGGCAGGGGGCGCGGCGCCGG + Intergenic
901631566 1:10650788-10650810 GACGGCCGGGGCCTGGGCCCTGG + Intronic
901654824 1:10763165-10763187 GGCCCCCGGGGCCTGGGCTGTGG - Intronic
903078053 1:20787154-20787176 GGCGGCCGGGGAGTGGGCGCGGG - Intronic
903468372 1:23568136-23568158 GGCCGCCGGGCGCGGGGCGCGGG - Intergenic
903497391 1:23778717-23778739 GGCCGCCTGGGGCTTGGGGCGGG + Intronic
903750620 1:25618147-25618169 GGCCGCCGTGGCCTCCTCGCGGG - Exonic
903950674 1:26994302-26994324 GGCCGCGGCGGCCGCGGCGCGGG - Exonic
904753221 1:32754018-32754040 GGCCGCCGGGCCCGCAGCCCCGG - Intronic
904762636 1:32817077-32817099 TGGGGCCGGGGACTCGGCGCTGG - Intronic
904782941 1:32964412-32964434 GGCCGCCGAGGCCGAGGCGGAGG - Exonic
904822939 1:33256798-33256820 GGCCGCCTGCGCCTCGGGCCCGG + Intronic
905066890 1:35192251-35192273 GGCCGCCGGGCCCGCCGGGCGGG + Exonic
905463076 1:38134016-38134038 GGCGGCCGGGGCGGCGGAGCAGG + Intergenic
907429885 1:54405789-54405811 GCCCGCCGCGGCCTCGGGGAAGG + Intronic
908258107 1:62318949-62318971 GGGAGCCGGGGACGCGGCGCTGG + Intronic
909392949 1:75136522-75136544 GCCCGCCCCAGCCTCGGCGCGGG - Intronic
910760141 1:90725059-90725081 GGCTGCAGGGTGCTCGGCGCAGG - Intergenic
912993454 1:114510980-114511002 GGCCGCCGGGCCCGCCGCGCAGG - Exonic
914702892 1:150150193-150150215 TGCCGCCGAGGCCCCGACGCGGG + Exonic
914900541 1:151709031-151709053 GGCCGCCTGGGCCTCAGCGTGGG + Exonic
915128090 1:153679519-153679541 GACCGCCGGCGCCCCGGCGCTGG + Exonic
917962320 1:180154836-180154858 GGCAGGCGGTGCCGCGGCGCCGG + Exonic
919981203 1:202643784-202643806 GGGCTCCGGGGGCTCGGAGCCGG - Intronic
921934854 1:220786950-220786972 CGCCGCCGGCTCCTCCGCGCTGG + Exonic
922239970 1:223749043-223749065 GGCCTCCGAGTCCGCGGCGCTGG - Exonic
922505226 1:226122140-226122162 GGCGGGAGGGGCCCCGGCGCTGG + Intergenic
922739367 1:228006872-228006894 GCCCGCCGGGGCCGGGGCCCGGG - Intergenic
922937194 1:229431949-229431971 GGCCGGCGGGGCCTGGGGGCCGG + Intronic
923007887 1:230066987-230067009 GGCTGCGGGGGCCGGGGCGCGGG - Intronic
923372660 1:233328344-233328366 GGCCGCGAGGGCGGCGGCGCGGG - Exonic
923506303 1:234609255-234609277 GGCGGCCGAGGCCGCGGCGCCGG + Exonic
1063418234 10:5890292-5890314 CGCCGCCGGGCCCGCGCCGCCGG - Intronic
1064086524 10:12349748-12349770 GGGCGCCGGGGGCGCGGCGCGGG - Exonic
1066370283 10:34814464-34814486 TGCCCCCGGGGCCTGGGAGCCGG + Intronic
1067944957 10:50683529-50683551 GGCAGTCGGGGCCTTGGGGCCGG - Intergenic
1069386258 10:67885228-67885250 GGCGGCTGGGGGCTCGGGGCAGG + Intronic
1069909564 10:71751155-71751177 GGCCTCCTTGGCCTCGGCCCTGG - Exonic
1070866458 10:79710400-79710422 GGCAGTCGGGGCCTTGGGGCCGG - Exonic
1071633368 10:87232621-87232643 GGCAGTCGGGGCCTTGGGGCCGG - Exonic
1071646817 10:87364839-87364861 GGCAGTCGGGGCCTTGGGGCCGG - Exonic
1072253704 10:93601142-93601164 CGCGGCCGGGGCCTCGGGGCCGG - Intronic
1074592061 10:114822291-114822313 GGCGCCCGGGGCCTCGGGCCTGG + Intronic
1074815410 10:117138220-117138242 GGCCGCCGAAGCCTCCCCGCGGG - Intronic
1074995491 10:118754451-118754473 GGCCGCCTTGGCCACGGCGGCGG + Exonic
1075866013 10:125719827-125719849 GGCCGGCGGACCCTCGGCTCCGG - Exonic
1075948720 10:126459428-126459450 TGCAGCAGGGGCCTCGGCGCTGG - Intronic
1076374209 10:129972754-129972776 GGTTGCCGGGGCCCCGGAGCCGG - Intergenic
1076821681 10:132942768-132942790 GGACGCCGGGGGCTCCGCGCGGG + Intronic
1076853296 10:133103476-133103498 GGCCGCCGGGGCGGCGGGGGAGG - Intronic
1076905260 10:133358022-133358044 GGCGGGCGGGGCCTAGGGGCGGG + Exonic
1077065060 11:637358-637380 GGCCGCGGGGGCATCTGCGGGGG + Exonic
1077214811 11:1390830-1390852 GGCCACCGGGGCCTCCGGGCAGG + Intronic
1077430864 11:2515448-2515470 GGCAGCAGGGGCCTCGGGGACGG - Intronic
1077916059 11:6612126-6612148 GGCCTCCGCCGCCTCGGCCCCGG - Exonic
1078246218 11:9574535-9574557 GGCGGCCGGGGCCGCGGCGCCGG + Intronic
1078334228 11:10451079-10451101 GGCCGCAGGGTCCGCGGGGCTGG - Intronic
1078594420 11:12674487-12674509 GGGCGGCGGGGCCGCGGCGGCGG - Intergenic
1080628610 11:34052510-34052532 GGGAGCCGGGGCCGCCGCGCCGG + Exonic
1081492584 11:43579622-43579644 GCCCGCCGCCGCCGCGGCGCGGG - Intronic
1081831904 11:46121519-46121541 GGCCGGCGGGGCCGCGCGGCGGG - Intergenic
1081937829 11:46917535-46917557 AGCCGCCGGGCCCTCGCGGCAGG - Intronic
1081938143 11:46918601-46918623 GGTGGCCGGGGCTGCGGCGCGGG - Exonic
1082003709 11:47408550-47408572 GGCCGCCCGGCCCCCGGCCCGGG - Intronic
1083316301 11:61816719-61816741 GGCCGCCGAGACCGCGGCTCAGG - Exonic
1083335056 11:61917419-61917441 GGCGGGCGGGGACGCGGCGCTGG - Exonic
1083886520 11:65576009-65576031 GGCGGGCGGGGCTCCGGCGCGGG - Intergenic
1083998451 11:66283666-66283688 GGCCGCAGAGGCCTCAGCCCTGG + Exonic
1084171279 11:67401982-67402004 GGGGGGCGGGGCCTCGGCGGCGG + Intronic
1084177068 11:67428516-67428538 GGCCGACGGGCCCGCGGGGCCGG + Exonic
1084621102 11:70270775-70270797 GGGCCCCGGGGCCGCGGCGTGGG + Exonic
1084891742 11:72240127-72240149 GCCCGCCGCGCCCTTGGCGCTGG + Exonic
1085205814 11:74731325-74731347 GGCCGCGGGGGCCTGGGGCCCGG + Intronic
1088268415 11:108009243-108009265 GGCCGACGGGCCCTGGGCCCTGG + Exonic
1089499818 11:118925505-118925527 ACCCGCCGGGGCCGGGGCGCGGG + Intronic
1089564508 11:119363802-119363824 GGACCCCAGGCCCTCGGCGCGGG + Intronic
1090230813 11:125102242-125102264 GGCCGCCGCTGCCTCCCCGCGGG - Exonic
1090710081 11:129375963-129375985 GCCCGCTGGGGCCGCGGGGCTGG - Exonic
1090788639 11:130070515-130070537 CGGCACCGGGGCCTCGGCTCCGG + Intronic
1091286591 11:134411860-134411882 GGGCGCCGGGGCCGGGGCGTAGG - Intronic
1091550291 12:1530989-1531011 GGCAGCCGGGGCGGCGGCGGCGG - Intronic
1091743563 12:2976782-2976804 TGCCGCCCGGGCCTGGGGGCTGG + Intronic
1092239557 12:6828584-6828606 CGCGGCCGGGGCTTGGGCGCCGG + Exonic
1092256062 12:6927585-6927607 GGCCGAGGGGGCCGGGGCGCGGG - Intronic
1092659478 12:10722968-10722990 GGGCGCCGGGGCCGCGGCCTGGG + Exonic
1094807687 12:34108053-34108075 GGACGCCGCGGCCTCTGCCCCGG - Intergenic
1096102976 12:48980530-48980552 GGCCCCCGGGGCCGCGCCGCCGG - Exonic
1096389483 12:51217731-51217753 GGCCGCCGTGGCCCCGGCCCCGG - Intergenic
1096674925 12:53221216-53221238 GGCGGCCCGGGCCGCGGCGGAGG - Intronic
1098255340 12:68610752-68610774 GCGCGCCGGGTCCTCGGCGCCGG - Intergenic
1101409503 12:104457103-104457125 GGCCGCCGCTGCCTGGTCGCGGG - Exonic
1102025969 12:109714496-109714518 GGCCGCCGGGCTCCCAGCGCGGG + Exonic
1102937654 12:116911181-116911203 GGCCTCGGGGGACCCGGCGCTGG + Exonic
1103701199 12:122849524-122849546 GGCCGCAGGGGCCGTGGGGCTGG + Intronic
1103749980 12:123151576-123151598 GGACGCCCGGGCCGCGGCCCAGG + Intergenic
1104376335 12:128267577-128267599 TGCGGCGGGGGCCTCGGCGGGGG + Intronic
1104836833 12:131797273-131797295 GGCCGCGGGGGCCGCGGGCCGGG - Exonic
1105349500 13:19602439-19602461 CGCCGCCGGGGCGCCAGCGCTGG + Intergenic
1105805624 13:23950307-23950329 GGCAGCCTGGGCCTGGGCCCTGG + Intergenic
1110705834 13:78601795-78601817 GGCCGACGTGGGCTCGGCGCTGG - Exonic
1110782382 13:79481298-79481320 GGCCGCCGAGACCTCCGCGTTGG - Exonic
1112216351 13:97434383-97434405 GGCCGCCGGGGCCGGGGCTGGGG + Exonic
1112336936 13:98523862-98523884 GGCCGTCGGGGCCTCCGCTGGGG - Intronic
1113445220 13:110360909-110360931 GGCAGCACGGGCCTCGGCCCAGG - Intronic
1113493984 13:110713802-110713824 GGCAGCGGCGGCCGCGGCGCTGG + Intronic
1113656188 13:112068843-112068865 GGACGCCGGGGACTCTGCGGCGG + Exonic
1113805991 13:113110238-113110260 GGCCGCCGGAGACGCGGTGCGGG + Intronic
1115474513 14:33800463-33800485 GGCGGCCGCGCCGTCGGCGCCGG - Exonic
1115906689 14:38209465-38209487 GGCAGCAGGGGCCCCGGGGCCGG + Exonic
1117353474 14:54902539-54902561 GGCCGCGGGGGCTTCTCCGCCGG + Exonic
1118137490 14:63045550-63045572 GGCGGCCGGCGCCTGGGCGCGGG + Intronic
1119249068 14:73136661-73136683 GGCCGCCCGGGCCGCGAAGCCGG + Intronic
1119330023 14:73786926-73786948 GGCGGCCGGGGTCGGGGCGCCGG - Intronic
1121535722 14:94689618-94689640 GCTGGCCGGGGCCTCCGCGCTGG + Intergenic
1121595249 14:95157315-95157337 GGCGGCGGGGGCGGCGGCGCCGG - Intronic
1122221035 14:100239211-100239233 GGCCGCCGCGGCCGTGGCGGCGG + Exonic
1122543298 14:102509492-102509514 GGCGGCCGCGGGCGCGGCGCGGG + Intronic
1122544959 14:102517103-102517125 CGCCCCCGGGGCCAGGGCGCTGG - Intergenic
1122558014 14:102592012-102592034 GGGGGCGGGGGCCGCGGCGCGGG - Intergenic
1122626950 14:103089760-103089782 GGCTGCTGGGTCCTCGGAGCAGG - Intergenic
1122697337 14:103562499-103562521 GGCCGCACGGGGCTGGGCGCTGG + Intronic
1122917259 14:104865024-104865046 GGCCAGCGGGGCCTGGGCGGTGG + Intergenic
1122930940 14:104932844-104932866 GCCCGCGGGGGCCACGGTGCAGG + Exonic
1123024882 14:105419870-105419892 GGCCTCGGCGGCCTCGGCGGCGG + Exonic
1123964083 15:25438500-25438522 GGCCGCCGCAGCCCAGGCGCGGG - Exonic
1124496896 15:30192514-30192536 GGGCTCCGGGGGCTCGGAGCCGG - Intergenic
1124629238 15:31327535-31327557 GGCCGCCGCGCCTTCGGCGCCGG - Exonic
1124746680 15:32346133-32346155 GGGCTCCGGGGGCTCGGAGCCGG + Intergenic
1125758692 15:42083090-42083112 GGCCACAGGGGCCTTGGCCCTGG + Intronic
1127769498 15:62219473-62219495 GGCCGCCGGGTCCTCTGCCTAGG + Intergenic
1128597191 15:68963802-68963824 GGCCGCAGGGTCCTCTGCGTAGG - Intronic
1128651133 15:69414515-69414537 GGGGGCCGAGGCCTCGGGGCTGG + Intronic
1129189144 15:73927431-73927453 GGCGGCCGTGGCCTCGGCGGGGG + Exonic
1129644736 15:77419830-77419852 GGCCGCCAGAGCCCCGGCGGCGG + Intronic
1129780099 15:78264453-78264475 GGCCGCCGGAACCTCCGCGAAGG + Intronic
1130023677 15:80252049-80252071 GGTCGCCCTGGGCTCGGCGCCGG - Intergenic
1130115628 15:81002190-81002212 GGCCGCCGGGGCGGCGGCAGTGG + Exonic
1131693879 15:94855567-94855589 CGCCGCCGCCGCCTCAGCGCTGG - Intergenic
1131873690 15:96783620-96783642 GGCAGCCTGGGCCTCGGGGAAGG + Exonic
1132314677 15:100880815-100880837 GGCCTCCGAGGCCTCTGAGCTGG + Intronic
1132398263 15:101489630-101489652 GGCGGCCGGGGCCCGGGCGCAGG + Exonic
1132464825 16:72583-72605 GGCGGGCGGGGACTCGGCGCGGG - Exonic
1132480586 16:164729-164751 GGCGGGCGGGGCCGCGGGGCGGG + Intronic
1132679279 16:1133107-1133129 GGCCGCCGAGGCCTCCGCCCTGG - Intergenic
1132694176 16:1194719-1194741 GGCCCCCTGGCCCTCGGCGTTGG - Intronic
1132699851 16:1217713-1217735 GGCAGCAGGGGCCTCGGCCCAGG + Intronic
1132765750 16:1533399-1533421 GGCCCCCGGGGCCTGGAGGCTGG - Intronic
1132828897 16:1918143-1918165 GGCCGCCCGCGCCCCCGCGCCGG - Exonic
1132831351 16:1929894-1929916 GGCCTCCCGGGCCCGGGCGCGGG - Intergenic
1132847998 16:2009496-2009518 GGGCGCCGGGGGCGCGGCCCGGG - Intronic
1132942171 16:2513796-2513818 GGGCGCCGGGGCCGGGTCGCTGG + Intronic
1133188452 16:4116355-4116377 GGCCGCGGGGGACACGGCGGCGG - Intergenic
1133220207 16:4316389-4316411 GAACGCGGGGGCCTCGGCGAGGG - Intronic
1133304854 16:4802480-4802502 GGCCGGCGGGGCGGCGGGGCCGG - Intronic
1134134149 16:11668581-11668603 GGGCGCCGGGGCCCGGGGGCGGG + Intronic
1134172049 16:11976656-11976678 GGCGGGCGGGGCCTCGTCGGCGG + Intergenic
1136270227 16:29144137-29144159 GGCCGACTGGGTCTTGGCGCGGG + Intergenic
1136365404 16:29806997-29807019 GGCCGCCGGGGCCTGGGGCGTGG - Exonic
1136536411 16:30902382-30902404 GGCGGCGGGGGGCTCGGCCCGGG - Exonic
1136579402 16:31142667-31142689 GGCCGTCTGGGCCGCAGCGCGGG - Intronic
1136641529 16:31569357-31569379 GGGCGCCGGGGCCGCGGCTTGGG + Intergenic
1137031341 16:35527021-35527043 GGCAGCCAGGGCCTGGGCACCGG - Intergenic
1137738483 16:50742309-50742331 GACCATCGGGCCCTCGGCGCCGG + Intronic
1138105598 16:54285850-54285872 GGCCGCAGCGGCCGCGGCGTAGG + Exonic
1138360642 16:56425042-56425064 GGCGGCCGGGCCCGCGGGGCAGG - Intronic
1138619175 16:58197953-58197975 GGCCGGCGGGGCGGCGGGGCGGG + Intergenic
1139364881 16:66427172-66427194 CGCCGCCGCTGCCTCGGCCCGGG + Intergenic
1139451242 16:67029382-67029404 GGCCGGCGCGGCCTCAGGGCGGG + Exonic
1139528205 16:67529159-67529181 GGCCGCCAGGGCCTTGCCGTGGG - Intronic
1141608854 16:85170193-85170215 GGGCGCAGAGGCCTCGGCGCAGG + Intergenic
1141699798 16:85637180-85637202 GGCCGCCGGGGGCTGGGGGAGGG - Intronic
1141947968 16:87323308-87323330 GGCTGCCTGGGCCCCGCCGCAGG + Intronic
1142163332 16:88570623-88570645 GGCCGCCGAGGCGGCGGCGGCGG + Intronic
1142213207 16:88818097-88818119 GGCCTCCTGGTACTCGGCGCTGG + Exonic
1142299404 16:89247690-89247712 GGGCGCCGGGGGCGTGGCGCGGG + Intergenic
1203142923 16_KI270728v1_random:1780633-1780655 GGCCGCCGGGTCTTCAGCACAGG + Intergenic
1142762428 17:2050248-2050270 GGCGGCCGGGGCCGCGGTCCTGG + Intergenic
1142764668 17:2058487-2058509 GGCCGGCGCGGCCGGGGCGCTGG + Exonic
1142811840 17:2399219-2399241 TGCTGCCAGGGCCTCGGCTCTGG - Intronic
1142855103 17:2724698-2724720 TGGCGCCGGGGCCCGGGCGCGGG + Intergenic
1142876288 17:2853636-2853658 GGCGGCCGAGGCCGGGGCGCGGG + Intronic
1143078610 17:4365884-4365906 GGCCGCCGGACCTTCGGGGCCGG - Intronic
1143485372 17:7251316-7251338 GGCCGCGGGGGCCCCGGGGCCGG - Exonic
1143633365 17:8151162-8151184 GGCCTCCAAGGCCTCGGAGCAGG + Intronic
1143747352 17:9003928-9003950 GGCCGGCGGGTCCGCGGCGCGGG - Intergenic
1145110356 17:20156455-20156477 GGGCGCCGGGGCCGCCGGGCAGG + Intronic
1146124807 17:30223020-30223042 CACCGCCGTGGCCTGGGCGCAGG + Intronic
1146322722 17:31859166-31859188 GGCCGCCGGGGCCCAGGCGCAGG - Exonic
1146353148 17:32112666-32112688 TGCCGCGGCGGCCTCAGCGCTGG - Intergenic
1147179097 17:38673821-38673843 GGCCGCTGGAGCCTCGGGGGCGG + Exonic
1147393450 17:40123172-40123194 GGCCGCCAGGGTCCCGGCGGTGG - Intronic
1147705607 17:42423026-42423048 AGGCTCCGGGGCCTCGGCGTCGG + Exonic
1147723616 17:42553488-42553510 GGACGCCGTGGCCTCTGTGCTGG + Exonic
1148122612 17:45221854-45221876 GGCCGCCGGGGCCAGAGGGCTGG - Exonic
1148323679 17:46771635-46771657 GGCCGCCGGGCCCGGGCCGCCGG + Intronic
1148782451 17:50129622-50129644 GGCCGCGGGGGGCTCCGGGCGGG + Exonic
1148945753 17:51260488-51260510 GGCCCCCGGGGCTTCGGCGGCGG + Intergenic
1149610500 17:57955256-57955278 GGCCGCAGGGGCCGGGCCGCGGG + Exonic
1149994576 17:61399976-61399998 GGGCGGCGGGGGCTCTGCGCGGG - Exonic
1150649615 17:67001336-67001358 GGCCTCAGGGGCCTGGGAGCTGG - Intronic
1150840374 17:68600997-68601019 GGGCCCCGGGGCGCCGGCGCCGG + Exonic
1151492855 17:74443116-74443138 GCACCCCGGGGCCTCGGAGCAGG - Intronic
1151580107 17:74972725-74972747 AGCCGCGGGGGCCGCGGAGCTGG - Exonic
1151957093 17:77385870-77385892 AGCCGCAGGGGCCTTGGAGCAGG - Intronic
1152245489 17:79182886-79182908 GGCCGCTGGGGACTCGGGGCGGG - Intronic
1152718495 17:81911224-81911246 GGCCGCGGGGGCGCCGGGGCCGG - Intronic
1152748332 17:82051403-82051425 GGCCCCCGGAGGCTCCGCGCGGG - Intronic
1152820452 17:82435233-82435255 GGTCGCCGGGGCCTGGGGGCAGG - Intronic
1152852964 17:82648416-82648438 GGCCGCGGCGGCCTCAGCGCCGG - Exonic
1152888517 17:82866686-82866708 GGCCTCTGGGGCCTCTGCCCAGG - Intronic
1152892300 17:82889379-82889401 GACAGCCGGGGCCTCCGCGTGGG + Intronic
1153942227 18:9988250-9988272 CGGCCCAGGGGCCTCGGCGCAGG + Intergenic
1153942615 18:9990918-9990940 GGCCGCCCCGGTCTGGGCGCTGG - Intergenic
1154070571 18:11148829-11148851 GGCCGCAGGGGGCCGGGCGCCGG - Intergenic
1154501017 18:14998117-14998139 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
1156088762 18:33440601-33440623 GGGCGCTTGTGCCTCGGCGCGGG - Intronic
1156088766 18:33440621-33440643 GGGCGCTTGTGCCTCGGCGCGGG - Intronic
1156452535 18:37274838-37274860 GGCGGCCTGCGCCTCGGCGTGGG + Exonic
1156806087 18:41184167-41184189 GGCCGCAGGGACCTCTGCCCAGG + Intergenic
1157260970 18:46174850-46174872 GGCCACTGCGGCCGCGGCGCCGG - Intronic
1159590114 18:70325068-70325090 GGCCGCAGAGGCCACGGCGCGGG - Exonic
1160418133 18:78726333-78726355 GGCCGGTGAAGCCTCGGCGCTGG + Intergenic
1160510678 18:79451841-79451863 TGCGGCCTGGGCTTCGGCGCTGG + Intronic
1160540117 18:79616746-79616768 GGCCGCCGGGGCCCGGGCTGGGG + Intergenic
1160705808 19:529732-529754 GGACGCCTCGGCCTCGGCCCTGG + Intergenic
1160715065 19:572781-572803 GGAGCCTGGGGCCTCGGCGCGGG + Intronic
1160719163 19:589997-590019 GGCGGCGGCGGCCCCGGCGCGGG - Exonic
1160735944 19:662540-662562 GGGCGCCGGCGCCTCGCTGCAGG - Intronic
1160763739 19:798048-798070 TGGCGCCGGGGCCTCGCCGCGGG + Intronic
1160791371 19:925288-925310 TGCAGACGGGGGCTCGGCGCGGG - Intergenic
1160864318 19:1250329-1250351 CGCCGCCGGGGGCCCCGCGCCGG - Exonic
1160967597 19:1753472-1753494 GGCCGCCGGCGCCCGGGCCCGGG - Exonic
1160991986 19:1863788-1863810 GGCCGCCGGGGGCGGGGCTCGGG + Intergenic
1161006770 19:1941114-1941136 CGCAGCCGCGGCCACGGCGCCGG - Intergenic
1161015105 19:1979460-1979482 CGCCAGCGGGGCCTCGGCGGGGG - Intronic
1161108710 19:2456645-2456667 GGGCGCCGGGGCTTAGGGGCCGG - Intronic
1161438727 19:4279095-4279117 AGCTGCCGCGGCCTCGGCCCCGG + Exonic
1161594208 19:5142911-5142933 GGCCGCCAGGGCCCCGGTGCTGG + Intronic
1161793811 19:6375401-6375423 GCCCGCCGTGGGCTCGGCCCTGG + Exonic
1162126015 19:8499880-8499902 GGCTGACCGGGCCTGGGCGCAGG - Intronic
1162535738 19:11262207-11262229 GGCCGCGGGGGTCCCGGCGGGGG - Intronic
1162609523 19:11738582-11738604 GGCCGCTGCGGCCCCGGCCCCGG - Intronic
1162935329 19:13978994-13979016 GGCGGCCGGGGCGGCGGCTCCGG + Intronic
1163111119 19:15161388-15161410 GGCCGCAGGGGCCCCGGGGGCGG - Exonic
1163442447 19:17328742-17328764 GGCCGCAGGTGCCTCAGCGGGGG - Exonic
1163776858 19:19224066-19224088 GGCCTCCTGGGCCTCAGCGAAGG - Exonic
1164693567 19:30227646-30227668 GGCCGGCGGGGCCGGGGCGAGGG + Intergenic
1164958462 19:32406172-32406194 GGCCGCCGGGGTCGCAGCCCAGG - Exonic
1165749881 19:38253210-38253232 GGCCCCGGGAGCCTCGGGGCTGG + Intronic
1165803140 19:38565201-38565223 GGCGGCGGGGGCGACGGCGCGGG + Exonic
1165879470 19:39032179-39032201 GGCCGCCCGGGTCCCCGCGCCGG - Exonic
1166126334 19:40717266-40717288 CCCCGCCGGGGCCCCTGCGCCGG - Exonic
1166317981 19:41999206-41999228 GGCCGCCCGGGCGTCGGCGCCGG + Exonic
1166358572 19:42242218-42242240 GGCAGCGGAGGCCCCGGCGCAGG - Exonic
1166876610 19:45901758-45901780 GGGCGCCATGGCCTCGGCGGCGG - Exonic
1167134529 19:47608989-47609011 GGGCGCGCGGGCCTGGGCGCGGG + Intronic
1167157123 19:47745653-47745675 CGCCGCCGCCGCCTCAGCGCTGG - Exonic
1167268311 19:48494034-48494056 GGCCGCCGCGGGCCCGGCCCCGG + Exonic
1167501334 19:49850602-49850624 GGCGGGCGGAGCCTGGGCGCCGG + Intergenic
1167638390 19:50667790-50667812 GGGCGGCGGGGCCTCGTAGCGGG + Exonic
1167643644 19:50694924-50694946 CGCCGCCGGGGCCCCAGGGCTGG + Intronic
1167738832 19:51312045-51312067 GGACGCCGGGGTCTGGGCCCGGG + Intronic
924962318 2:46128-46150 CGCCACCGGGGCCGGGGCGCGGG + Exonic
926667678 2:15542495-15542517 GGCCGCAGGGTCCTCGGCCTAGG + Intronic
926914270 2:17878262-17878284 AGCCGCCGGGGCCGCGGGGGAGG + Intronic
927159218 2:20242386-20242408 GGCCCCCGGACCCGCGGCGCAGG + Intergenic
927472210 2:23385221-23385243 GGCTGGCGCGGCCGCGGCGCGGG - Exonic
927508385 2:23629074-23629096 GGGCGGCGGGGCCTCTGAGCAGG + Intronic
927847616 2:26479598-26479620 GGCCCCAGCGGCCTCGGCCCCGG - Exonic
927881489 2:26692813-26692835 GGCGGCCGGGGCCGAGGCGCGGG + Exonic
928085711 2:28345150-28345172 GGCCGCCTGGGTGTCGGTGCGGG - Intergenic
929936389 2:46297253-46297275 AGCCGCCCGGAGCTCGGCGCGGG + Intronic
931695171 2:64865705-64865727 GGCGGCCGCGGCCTCGGCGGCGG + Intergenic
932342996 2:70978574-70978596 GGCCCCCGGGGGCGGGGCGCCGG + Intronic
932496759 2:72149411-72149433 CGCTGCCGGGGCTTCGGCCCAGG - Intergenic
932567688 2:72919982-72920004 GGCCGCCGCGGCCGAGGGGCTGG + Intronic
933907970 2:86914052-86914074 GGCGGCCTCGGCCTCGGCCCCGG + Intronic
933907991 2:86914101-86914123 GGCGGCGGCGGCCTCGGCCCCGG + Intronic
934011545 2:87825363-87825385 GGCGGCGGCGGCCTCGGCGTAGG - Intronic
934503192 2:94874494-94874516 GGCCTCCGGGGCAGCGGTGCTGG + Intronic
935112221 2:100104490-100104512 GGCGGCCCGAGCCTCGGCGGCGG - Exonic
935592469 2:104855358-104855380 GGCCGGCGGGGGCCCGGGGCGGG + Intergenic
935746422 2:106193847-106193869 GGGCGCGGGGGACTCGGCGGCGG - Intronic
937047101 2:118857643-118857665 GGCCGCCGGGGTCCTGGCCCTGG + Intergenic
937997083 2:127702129-127702151 GGTCGCCTGGGCCGCGGCGCCGG + Exonic
938500188 2:131828306-131828328 GGGCTCCGGGGCCCCCGCGCTGG - Intergenic
940035741 2:149310566-149310588 GGCGGCCGGGGACTTGGAGCAGG - Intergenic
940640872 2:156342766-156342788 TGCTGCCGGGGCCCCGGGGCGGG + Intergenic
941819177 2:169827713-169827735 CGCCGCCGCGTCCTCGCCGCCGG - Exonic
942024931 2:171900824-171900846 GGCCGCAGGGTCCTCTGCCCAGG + Intronic
942890490 2:180981006-180981028 GGCGGCCGGGGCGGCGGCGGCGG + Intronic
942947271 2:181684110-181684132 GGGTGTCGGGGCCTGGGCGCGGG + Intergenic
943578229 2:189654349-189654371 GGCCGCCGGGTCCTCTGCCTAGG + Intergenic
944154046 2:196592847-196592869 GGGCGCCGGGGCCGCGGGTCCGG - Intronic
945045284 2:205776328-205776350 GGCCGCCGGGGGCGCCGTGCTGG + Intronic
946268308 2:218568177-218568199 GGGCTCCGGACCCTCGGCGCAGG - Exonic
946321989 2:218959784-218959806 TCCCGCTGGGGCCTGGGCGCCGG + Exonic
946326002 2:218985076-218985098 CGCCGCCGGGGACTGGGCGGTGG + Exonic
946362768 2:219229147-219229169 GGCCGGCTGGGCCTGGGCTCAGG + Exonic
947792611 2:232876723-232876745 GGCCGCCAGGGCATCGGAGCGGG + Intronic
948216538 2:236237337-236237359 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216553 2:236237362-236237384 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216568 2:236237387-236237409 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948216583 2:236237412-236237434 GGGGGCCGGGGCCGGGGCGCGGG + Intronic
948540010 2:238684194-238684216 GGCCGCGGGGGCCTATGGGCAGG + Intergenic
948645226 2:239400436-239400458 GCCCGCCGGGGCGGGGGCGCGGG - Exonic
948824718 2:240568618-240568640 GACGGGCGCGGCCTCGGCGCCGG - Intronic
948824795 2:240568923-240568945 GGCAGCGGGGGCGGCGGCGCGGG - Exonic
949000441 2:241610143-241610165 GGGCACCAGGGCCGCGGCGCCGG + Intronic
1168965221 20:1894677-1894699 AGCAGCCGGGGCCCGGGCGCCGG + Intronic
1169247448 20:4034643-4034665 GGCCGCAGGGACCTCTGCCCAGG - Intergenic
1169437985 20:5610732-5610754 GGGCGTCGGGGCCGAGGCGCGGG - Intronic
1169914688 20:10673602-10673624 GGCCGCAGGGGCAGCGGCGACGG - Exonic
1170578417 20:17681388-17681410 GGCCGCAGGGCTCGCGGCGCAGG - Intronic
1170889954 20:20368383-20368405 CGGCGCCGGGGGCTCGGCGCGGG - Exonic
1172408226 20:34704604-34704626 GGCCGCCGGGGCCGCGTTCCCGG + Intronic
1172436348 20:34931376-34931398 GGCAGCAAGGGCCTCGGCGATGG + Exonic
1172702765 20:36863175-36863197 GGCCGCCGCGGCCCAGGCCCGGG - Exonic
1174263970 20:49318393-49318415 GGCCACGGGGGCCTGGGAGCGGG + Intergenic
1174873978 20:54208173-54208195 GGCCGCTGGGGCCCGGGCGCGGG + Intronic
1175108228 20:56629219-56629241 CGGCGCCTGGGCCTCCGCGCCGG + Intergenic
1175847021 20:62064838-62064860 GGCCGCCGGGGGCCCCGCGGGGG - Exonic
1175911452 20:62407174-62407196 GGCCGCTCGGGCCCCGCCGCAGG - Exonic
1175927549 20:62478268-62478290 AGGTGCCGGGGCCTCGGTGCGGG + Intergenic
1176005747 20:62861574-62861596 GGGCGGCGGGGACGCGGCGCTGG - Exonic
1176015545 20:62929359-62929381 GCGCGCCTGGGCCTCGGCGCTGG + Intronic
1176068848 20:63215819-63215841 CGCGGCCGGGGCCGAGGCGCGGG - Intronic
1176194260 20:63830434-63830456 GGGCGCAGGGGCCTCGGGGCGGG - Intronic
1176548598 21:8212235-8212257 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176556492 21:8256443-8256465 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176556834 21:8257562-8257584 GGACGGCGGGGCCTCGGAGGAGG - Intergenic
1176567529 21:8395270-8395292 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176568952 21:8400070-8400092 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1176575431 21:8439485-8439507 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1176576866 21:8444305-8444327 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1176952687 21:15065057-15065079 GGCCGCGGCGGACTCGGCGGCGG - Intergenic
1178992265 21:37366347-37366369 GGCTGCGGGGGCGGCGGCGCGGG + Intronic
1179882569 21:44299763-44299785 TGCCACCGGGGCCTCGGCGCTGG + Intergenic
1179893701 21:44350282-44350304 GCCCGCCGGGGCCGGGGCGAGGG + Intronic
1180045026 21:45301341-45301363 GGCGGCCGGGGCCACGGGGGTGG - Intergenic
1180159616 21:45993212-45993234 GGCCGCCGGCATCTCGGCTCTGG - Intronic
1181057711 22:20267890-20267912 GGCCGCTGGCGCCCCGGCCCCGG - Intronic
1182237006 22:28883820-28883842 GGCCGCGGGGGCGGCGGCGCAGG - Exonic
1183149814 22:36028631-36028653 GCCCGCCGGGTTGTCGGCGCGGG + Intergenic
1183483677 22:38078102-38078124 GGCAGCCGGAGCCTGGGCGGAGG + Intergenic
1183710864 22:39502459-39502481 GGCCGCCGGCGGCTGGGCGGCGG + Intronic
1183942067 22:41301612-41301634 AGCTGCCGGGGCGGCGGCGCCGG + Exonic
1183966604 22:41446324-41446346 GGCCGGCTGGGTCTCGGGGCGGG + Intronic
1184381199 22:44145728-44145750 GGCCGCAGAGGCCTCTCCGCCGG - Intronic
1184493745 22:44825541-44825563 GGCAGCGGGGGCCGCGGCGGTGG - Exonic
1184663693 22:45976860-45976882 GGCCGCCCGAGCCGCAGCGCGGG - Exonic
1185179744 22:49352513-49352535 GGCCGCTGTGGCGTCGGAGCTGG - Intergenic
1185332246 22:50257031-50257053 GGCAGGCAGGGCCTCGGGGCTGG - Intronic
1185409489 22:50674531-50674553 GGCCGACGGGGCTCCGGCGGGGG + Intergenic
1203253482 22_KI270733v1_random:128540-128562 GGCCGCCGCGGCGTCGGCGGCGG - Intergenic
1203261536 22_KI270733v1_random:173618-173640 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
949896006 3:8768119-8768141 GGCCCCCGGCGGCGCGGCGCTGG + Exonic
949970330 3:9397944-9397966 CGCTGCCGGGGCCTGGGCCCGGG - Exonic
950045519 3:9946658-9946680 GGCCGCGGAGGCCGCAGCGCTGG + Exonic
950583907 3:13879827-13879849 GGCCGCCGGGGCCGCGGGCCGGG + Exonic
951881405 3:27484204-27484226 GCGCGCCGGGGGCTCGGCGGCGG - Intronic
951907938 3:27722061-27722083 GGCCGCGGGGGCCCCTGCGCTGG + Exonic
955763813 3:62318988-62319010 CGACGCCGGGGCCTTAGCGCAGG - Intronic
956420209 3:69079947-69079969 GGCCCCCGGGGCTGCGGGGCGGG + Intronic
958560660 3:95744289-95744311 GGCCGCCGGGTCCTCTGCCTAGG - Intergenic
960097101 3:113699176-113699198 GGCAGCCGGGGACGCGGGGCAGG - Intergenic
960864288 3:122184295-122184317 GGCCGCTGCGGCCCCGGCCCCGG - Intronic
961260096 3:125595339-125595361 GGCCGCCGGGGGCGGGACGCCGG + Intergenic
961359332 3:126357258-126357280 GACCGCCGGGGCCTGGCCGCCGG - Exonic
961551457 3:127672587-127672609 CGCGGCCTGGCCCTCGGCGCGGG + Exonic
962316272 3:134361407-134361429 GGCTCCCGGGGCCTCAGCCCTGG + Intronic
962498335 3:135965511-135965533 AGCCGCTGTGGCCTCGGCGAGGG - Intergenic
962738790 3:138348394-138348416 GGGCCCAGGGGACTCGGCGCGGG + Intronic
962808879 3:138945718-138945740 GGGCGCCGGGGGCGCGGCGGTGG + Exonic
966378800 3:179323239-179323261 GGCCGCCGCCGCCTCTGCGTGGG + Intronic
966734627 3:183179263-183179285 AGCAGCCGGAGCCTCGGCGGCGG - Exonic
966874519 3:184314758-184314780 GGGCGCCGGGGCGGCGGCGCAGG - Intronic
966883664 3:184362948-184362970 GGCCCCGGGGTCCTCGGTGCCGG + Intronic
967171751 3:186827433-186827455 AGCAGCCGGGGCCGCGGCGGCGG + Intergenic
967176569 3:186866147-186866169 GGCCGCAGGGACCTCTGCCCAGG - Intergenic
967316250 3:188154219-188154241 GGCAGCCGGGGCAGCGGCGGTGG - Intronic
968090568 3:195895971-195895993 GGCCGCGGGGGCCTCGGGGCGGG - Intronic
968433962 4:575720-575742 CGCGGCCGGGGCCCCGGGGCCGG - Intergenic
968491510 4:892903-892925 TGCCCCCGGGGTCTCGGCCCTGG + Intronic
968562870 4:1294266-1294288 GGCTTCCGCGGCCTCCGCGCTGG + Intronic
968815189 4:2818276-2818298 GGCCGCCGCCGCCTCGTCCCGGG - Exonic
969330275 4:6470788-6470810 GGCTGCCCGGGCCTCCGGGCCGG - Intronic
969713716 4:8858628-8858650 GGCGGCCGGGGCCTCGCTTCTGG + Intronic
970617490 4:17781544-17781566 GGGCGCCGACGCCTCGCCGCAGG - Intergenic
972245781 4:37244543-37244565 GACGGCCGGGGCTTGGGCGCGGG - Exonic
972586208 4:40438830-40438852 GGCCGCCGGGTCCTCCGCCAAGG - Exonic
972960560 4:44447953-44447975 GGCCGCCGTGCCCTCGGGCCCGG - Exonic
973982089 4:56315413-56315435 CGTCGCCGGGGCCTCGGGGAGGG - Exonic
975166727 4:71186623-71186645 AGCCGCCCGGGCATCGGCGGCGG - Intergenic
976390005 4:84497671-84497693 GGCGGCCACGGCCGCGGCGCTGG + Exonic
980362724 4:131762536-131762558 GATCGCCGGGGCCGCAGCGCGGG + Intergenic
981615527 4:146639904-146639926 GGCTGCCAGAGCCTCGGCGCGGG - Exonic
982745790 4:159103338-159103360 GGCCGCGGCGGCGCCGGCGCCGG + Intergenic
983940666 4:173531590-173531612 GGCGGCCTGGGGCTCGCCGCTGG + Intergenic
984823505 4:183905219-183905241 CGCCGCCCGGGCCTGGGCGCTGG - Intronic
984964562 4:185128682-185128704 CCCCGCCTGGCCCTCGGCGCCGG + Intergenic
985539037 5:479287-479309 GGCGGCAGTGGCCTCGGGGCTGG + Intronic
985629852 5:1008744-1008766 GGCCGCCGGGGGCGCTGCGGGGG + Intergenic
985716805 5:1467526-1467548 GGCGGCAGGCGCCTCGGCACTGG - Intronic
985801392 5:2007254-2007276 AGGCGCCGGGGCCGCGGAGCTGG - Intergenic
986330519 5:6713652-6713674 GGGCGCGGGGGCCGCGGCGGCGG - Intergenic
987050806 5:14144914-14144936 GGCGGCGGCGGCCTCGGGGCCGG + Intronic
988564798 5:32312585-32312607 GCGCGCTGGGGCCTCCGCGCGGG - Intronic
990297676 5:54420167-54420189 GGCCGCAGGGACCTCGGCCTAGG - Intergenic
991987807 5:72308132-72308154 GTCCACCGCGGCCCCGGCGCTGG + Intronic
992939649 5:81750479-81750501 GGCGGCGGGGGCCTGGGCGCTGG - Intronic
995650083 5:114361089-114361111 GGCCGCCGGGTCCTGGGCTCTGG - Exonic
996379113 5:122845766-122845788 GGCCGCCGCCGCCTTGGCGCAGG + Intronic
997899637 5:137753459-137753481 GGCGGCCGGGGGCGCGGCGGTGG - Exonic
997950925 5:138241992-138242014 GGCCGCCCGGGGCACGGGGCTGG - Intergenic
997963256 5:138338327-138338349 TGGCGCTGGGGCCTCGGGGCGGG + Intronic
998166657 5:139848241-139848263 CGTCGGCGGGGCCCCGGCGCTGG - Exonic
998517706 5:142770709-142770731 GGCGGCCCGGGCCCCGGCGGAGG + Exonic
999809565 5:155114930-155114952 GGCCGCCGCGCCCCCGGCTCTGG + Intergenic
1000302883 5:159972024-159972046 GGCGGCCGCGGCCGCGGCACTGG - Exonic
1002512744 5:179733345-179733367 GGGCGCCGGGGCCGTGGCGGCGG - Exonic
1002524240 5:179806676-179806698 GGCGGCAGGGGCCCCGGCCCCGG + Intronic
1002703065 5:181140948-181140970 GGCAGCTGGGGCCTGGGCTCTGG - Intergenic
1003505561 6:6737395-6737417 GGCCGCTGGGTCCTCAGGGCAGG + Intergenic
1006123479 6:31822067-31822089 GGCCGCTGGGGCCTGAGGGCGGG - Intergenic
1006163135 6:32049538-32049560 GGCCTCCGGGGCCTCAGTGCTGG + Intronic
1006163777 6:32052938-32052960 GGGCTCCGGGGCCTCCGTGCTGG + Intronic
1006170202 6:32087898-32087920 GGCCGTGGGGGCCGCGGGGCTGG + Intronic
1006396158 6:33788864-33788886 GCCCGCCGCGGCCTCTCCGCGGG - Exonic
1007435310 6:41806315-41806337 GGCAGCCGGGCCCGCGTCGCGGG + Exonic
1007558105 6:42783143-42783165 CGCCGCCGCGGGCTCGGAGCGGG - Intronic
1007584203 6:42978871-42978893 GGGCTCCGGGGCCTGGGTGCGGG - Exonic
1009905668 6:69867495-69867517 GGCCGCTGTGGCTGCGGCGCCGG - Intronic
1010107095 6:72182716-72182738 GGCAGCCAGGGCCTCGCCGCCGG + Exonic
1015786255 6:136923191-136923213 GGCCGCCTGAGCCTGGGAGCTGG + Intronic
1016863814 6:148747231-148747253 GGCCGCTCGGGCCGCGGCGGCGG + Intergenic
1017662424 6:156687447-156687469 GGCCGCCGCGGCCGGGGCGTGGG - Intergenic
1018060124 6:160083590-160083612 GGCCGCAGGGACCTCTGCCCTGG - Intronic
1019927767 7:4204684-4204706 TGCCGCCGGGGCTGCGGCCCAGG - Intronic
1020255992 7:6503452-6503474 GCCGGCCGAGGCCTCGGGGCGGG + Intronic
1020274299 7:6615511-6615533 GGCGGCGGGGGCCGGGGCGCGGG + Intergenic
1020281532 7:6652594-6652616 GGCCGGCGGGGCCACTGCGGCGG - Exonic
1020418009 7:7968735-7968757 AGCTGCCGGGTCCTGGGCGCTGG + Intronic
1021600212 7:22356946-22356968 GGGCGCTGGGGCTGCGGCGCAGG + Intronic
1021868187 7:24979588-24979610 GAGCGCAGGGGCCGCGGCGCAGG - Intronic
1022739719 7:33109403-33109425 CGCCGCCGGAGCCGCGCCGCGGG - Intergenic
1024580043 7:50793617-50793639 AGGAGCCGGGGCCTGGGCGCAGG + Intergenic
1028641174 7:93043633-93043655 GGCCGCGGGGGCTGCGGAGCGGG + Intergenic
1029280429 7:99432054-99432076 GGCCGCAGGGACCTCTGCCCAGG + Intronic
1029461028 7:100694032-100694054 GGCCGCCGCGGCGTCGGGGGCGG + Intergenic
1030614865 7:111728795-111728817 GGGGGCCGGGGCCTCCGCGTCGG - Intronic
1031051880 7:116953435-116953457 GGGCGCCCGGGCCGCGGCGGCGG + Exonic
1032074497 7:128830172-128830194 GGCCCCCGGTGCCGCCGCGCTGG - Intergenic
1032192241 7:129771790-129771812 GGCAGCCTGGGCTTGGGCGCTGG + Intergenic
1032193932 7:129779362-129779384 GAGCGCCGGGGCCCCGGAGCTGG - Intergenic
1034179386 7:149126088-149126110 GGCGGCCGGGGCCTGGGCCTGGG - Intronic
1034182202 7:149147640-149147662 GGCCGCCGGGTCCTCTCCACAGG - Exonic
1034342715 7:150368689-150368711 GACTGCCGGGGCCGGGGCGCGGG - Intronic
1034732625 7:153400974-153400996 GGCTGCCGGAGCCACGGAGCTGG - Intergenic
1034781646 7:153887237-153887259 GGACGCCGGCGGCTCGGCCCCGG - Intronic
1034951295 7:155298359-155298381 GGCCGCCAGCCCCGCGGCGCTGG - Exonic
1034977611 7:155457608-155457630 CGCCGCCTCGGCCTCCGCGCGGG - Intergenic
1035004403 7:155644582-155644604 GGCTGCTGCGGCCTCGGCGGGGG + Intronic
1035159804 7:156942548-156942570 GGCCGCTGGGCCATCTGCGCTGG - Intergenic
1035435549 7:158856693-158856715 GGCCGCGGTGTCCTCGGCCCCGG - Exonic
1035580745 8:737965-737987 GCCCGCCGGGGCCGGAGCGCTGG + Intronic
1035656187 8:1307845-1307867 GGCTGCCGGGGACTGGGCGCTGG + Intergenic
1036454257 8:8893586-8893608 GGGCGCCGCGTCCCCGGCGCTGG + Exonic
1037855371 8:22367500-22367522 CGGCGCCCGGTCCTCGGCGCAGG - Intronic
1037876560 8:22551640-22551662 GGCCGGCGGGGAGGCGGCGCCGG - Intronic
1038613175 8:29071912-29071934 GGGCGCCGGGGCCTCGAGGTCGG + Exonic
1040501441 8:48008628-48008650 GGCCGCCGGGGCCTCGGCGCCGG - Intronic
1042040033 8:64580726-64580748 CGCCGCCGCCGCCTCGGCCCCGG - Exonic
1043502787 8:80873795-80873817 CGCCGCCGCCGCCTCGTCGCCGG - Intronic
1045118742 8:99012978-99013000 GGCTGCTGGGGCCGCTGCGCCGG - Intergenic
1048554024 8:135457762-135457784 GGCCCCCGGGTCCCCGCCGCTGG + Exonic
1049557037 8:143287931-143287953 GGCCGCCGGGTCCTCTGCCTAGG - Intergenic
1050972530 9:11895169-11895191 GGCCGCAGGGACCTCGGTCCTGG - Intergenic
1053399051 9:37801188-37801210 GGCCGACACGGCCTCGGCGCGGG + Exonic
1056143517 9:83707473-83707495 GGCCGCCTGGGGCTCGGGCCGGG - Intronic
1057052279 9:91935104-91935126 GGCCGCCGGGGACTTGGGACTGG - Intronic
1057488563 9:95505899-95505921 GGCGGCCGCGGCCGCCGCGCTGG - Intronic
1058508851 9:105694551-105694573 GGCCGCCCGCTCCTCCGCGCCGG - Exonic
1058885808 9:109320594-109320616 CGCGGCCTCGGCCTCGGCGCGGG - Exonic
1059325733 9:113503180-113503202 AGCCGCCAAGGCCTCGGGGCAGG + Intronic
1060296529 9:122347148-122347170 GGCCGCCCGGGCCGCTCCGCGGG - Intergenic
1060479265 9:124008603-124008625 GGCTGCCGGCGCCACGGAGCCGG - Intronic
1060770109 9:126326610-126326632 GCCGGCCGGGGCGGCGGCGCGGG + Intergenic
1060974254 9:127755204-127755226 GGCCGGCGGGGCAGGGGCGCAGG + Intronic
1061072990 9:128323101-128323123 GGCCGCCGGCTCCGCGGCGATGG + Exonic
1061257403 9:129460638-129460660 GGCCGCCGCGGGCCCGGCTCCGG + Intergenic
1061559680 9:131394354-131394376 GGCCCCCGGGCCCCCGGCGGCGG - Intronic
1062186670 9:135222044-135222066 GGACGCCGGAGCTTCGGCCCTGG + Intergenic
1062414076 9:136439225-136439247 GGCTGGCGGGTCCTCGCCGCTGG + Exonic
1062435959 9:136546654-136546676 GGGCGCCGCGGCCTCTGGGCAGG + Intergenic
1062499520 9:136846271-136846293 GGGCTCCGGGGCCCCCGCGCTGG + Exonic
1062584150 9:137241521-137241543 GGCCGCCGGGCCCCCTCCGCGGG + Intronic
1062597630 9:137306304-137306326 GGCAGCAGGGGCCTGGGGGCGGG - Intergenic
1203469882 Un_GL000220v1:111687-111709 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203471317 Un_GL000220v1:116507-116529 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1203477703 Un_GL000220v1:155659-155681 GGCCGCCGCGGCGGCGGCGGCGG - Intergenic
1203479138 Un_GL000220v1:160479-160501 CGCCGCCGGGGCCCCGCGGCGGG - Intergenic
1185889892 X:3814644-3814666 GGGGACCGGGGCCTCGGGGCGGG - Intergenic
1189325625 X:40109239-40109261 GGCTCCCCGGTCCTCGGCGCGGG + Intronic
1189534519 X:41923183-41923205 GGGCGGCGGGGCCGGGGCGCGGG + Intronic
1190246926 X:48696885-48696907 GGCGTCCGAGGCCCCGGCGCCGG + Intronic
1192214605 X:69150021-69150043 GGCCGCCGAGGCCTGGGAGCCGG + Intergenic
1192224974 X:69221742-69221764 GGCCGCCGAGGCCTGGGAGCCGG - Intergenic
1197774378 X:130110234-130110256 GAGCGCCGGGGCCCCGGCGTGGG - Intronic
1200068788 X:153517836-153517858 CGCCGCCGCGGCCTCGGCTCCGG - Intronic
1200119605 X:153784084-153784106 GGCGGCCGTAGCCTCAGCGCGGG + Exonic
1200128765 X:153830212-153830234 GGCCGCCGGCGCTGCGGCGGGGG - Intronic
1200252383 X:154560397-154560419 GGCCGCCCGGGCCCTGGCACGGG - Exonic
1200256426 X:154585353-154585375 GGCAGCAAGGGCCTCGGGGCCGG + Exonic
1200261343 X:154619050-154619072 GGCAGCAAGGGCCTCGGGGCCGG - Exonic
1200265384 X:154644019-154644041 GGCCGCCCGGGCCCTGGCACGGG + Intergenic
1200294957 X:154910632-154910654 GGCCGCAGGGACCTCTGCCCTGG + Intronic