ID: 1040504055

View in Genome Browser
Species Human (GRCh38)
Location 8:48030987-48031009
Sequence GTGGCCCAGAGCCACAATGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 191
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 179}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040504055 Original CRISPR GTGGCCCAGAGCCACAATGA AGG (reversed) Intronic
900301665 1:1981030-1981052 CTGTCCCAGAGCCACAACGGAGG + Intronic
900679575 1:3909217-3909239 GTGGAGGAGAGCCACCATGATGG - Intergenic
900936759 1:5770948-5770970 CTGGCCCAAAGCCACAGAGAAGG + Intergenic
902785520 1:18730541-18730563 CTGCCACAGAGCCCCAATGATGG + Intronic
904785487 1:32979491-32979513 CTGCCCCAAAGCCAAAATGACGG + Intergenic
905985214 1:42274632-42274654 GTGGCCTAAAGAGACAATGATGG + Intronic
907388488 1:54141168-54141190 GTGGCCCAGAGACACGAGGGTGG + Exonic
909611854 1:77559170-77559192 GTGGCTCAGAGCCATAAGGTGGG + Exonic
909995924 1:82279125-82279147 GAGGCCAAGAGGCACAGTGAGGG - Intergenic
910207848 1:84765500-84765522 GAGCTCCAGAGCCACAGTGAGGG + Intergenic
913179742 1:116310169-116310191 TTGTCCCAGCCCCACAATGATGG + Intergenic
913691549 1:121284484-121284506 GTGGCACAGAGCCAGAATCTGGG - Intronic
914145997 1:144995497-144995519 GTGGCACAGAGCCAGAATCTGGG + Intronic
915910448 1:159911843-159911865 GAGGCCCAGGGCCACAGTGGAGG - Intergenic
916806411 1:168265480-168265502 GTGACCCATAGCGACTATGATGG - Intergenic
917484388 1:175442312-175442334 GTGATCCAGAGCCAAACTGATGG - Intronic
918785876 1:188762267-188762289 GTGTCACTGAGCCAAAATGAAGG + Intergenic
919742882 1:200991189-200991211 GTGGCCTGGAGCCACACAGAAGG + Intronic
920231836 1:204475824-204475846 CTGGCCCAGAGCCAGGAGGATGG - Intronic
920478876 1:206302962-206302984 GTGGCACAGAGCCAGAATCTGGG - Intronic
920740376 1:208576323-208576345 GTGGCCAAAAACCACACTGATGG + Intergenic
921899510 1:220435493-220435515 GTTGCCCATAACCACAAGGAAGG - Intergenic
922816640 1:228453852-228453874 GTTGCCCACAGCCACCAAGAGGG + Intergenic
1064111825 10:12546271-12546293 ATGAACCAGAGCCACGATGAAGG + Intronic
1068217952 10:54008449-54008471 GAGGCCCAGATACAGAATGAGGG + Intronic
1068911580 10:62383501-62383523 GTGGCTCAGTGCAAAAATGAAGG + Intronic
1071495268 10:86163691-86163713 CTGGCCCAGAGCCACAAGCAGGG + Intronic
1075576014 10:123578078-123578100 GTGGCTCAGGGCTCCAATGAAGG - Intergenic
1076451319 10:130558920-130558942 GTGGTCCGGAGCCACATTTATGG + Intergenic
1076656839 10:132029879-132029901 CTGGCCCAGAACCACAGAGAAGG - Intergenic
1076926198 10:133489199-133489221 GTGGCCGAGCACCACAATGCTGG - Intergenic
1078607986 11:12794534-12794556 GAGGGCCAGGGTCACAATGATGG + Intronic
1079110895 11:17604537-17604559 GAGGCCCAGAGTCACACTGACGG - Intronic
1079403572 11:20126031-20126053 GTCGCCCACAGTCATAATGAAGG + Intergenic
1080566425 11:33513680-33513702 GTGGCCCAGAGACAATCTGACGG + Intergenic
1084571931 11:69965124-69965146 GTGGCCCATGGGGACAATGAAGG + Intergenic
1092088867 12:5787495-5787517 GTGGCCCAAAGTCACAAGGTTGG - Intronic
1094495468 12:30986511-30986533 GTGGCCCTGAGCTACACTAAGGG + Intronic
1097629785 12:62046086-62046108 GTAGCCCATGGCCATAATGATGG + Intronic
1099355413 12:81628944-81628966 GTGGCCCAGAGCCAATACAATGG + Intronic
1099741973 12:86649652-86649674 CTGGCCAAGAGCCAGATTGAAGG + Intronic
1101976682 12:109365731-109365753 ATGGCCCAGAGCCAACATGCAGG + Intronic
1103925246 12:124420305-124420327 CTGGCCCAGAGCAAACATGATGG + Intronic
1104014875 12:124955234-124955256 GTGGCCCACACCCACATTGGGGG - Intronic
1104917381 12:132272867-132272889 GTGGCGCAGAGCCACGGGGAAGG - Intronic
1107988161 13:45793706-45793728 GTAGCCCAGAGAGGCAATGAGGG - Intronic
1111021247 13:82455267-82455289 ATTGCCAAGACCCACAATGAAGG + Intergenic
1113132323 13:107051742-107051764 GTGTCACAGAGGCACTATGATGG + Intergenic
1117341375 14:54795139-54795161 GTGGGCCAGAGCCACCCTAAAGG - Intergenic
1118152623 14:63206020-63206042 CTGACCCAAAGCCAAAATGAAGG - Intronic
1122129074 14:99594642-99594664 TTGACTCAGAGCCACAAGGAAGG - Intronic
1122441323 14:101734219-101734241 GTGGCCCAGCGTGACAGTGAGGG + Intergenic
1123162161 14:106289015-106289037 GTGTACCAGAGACACAGTGAGGG - Intergenic
1123168536 14:106349272-106349294 CTGTGCCAGAGACACAATGAGGG - Intergenic
1123448147 15:20344259-20344281 GTGGCCGAGAGCCATAAGGCAGG + Intergenic
1124516002 15:30367882-30367904 GTGCTCCAGGGGCACAATGAGGG + Intronic
1124726918 15:32162849-32162871 GTGCTCCAGGGGCACAATGAGGG - Intronic
1125584841 15:40813007-40813029 CCAGCCCAGAGCCACAAGGAAGG + Intronic
1125973713 15:43933124-43933146 GGGGCCCAGAGCCAGACAGATGG + Intronic
1127950717 15:63803146-63803168 GTTGCCCAGGGGCACAATTATGG - Intronic
1129479290 15:75810329-75810351 GAGGCCTATAGCCAAAATGAAGG - Intergenic
1131347954 15:91668632-91668654 GTGGCCCAGATCTTCAAAGATGG + Intergenic
1132987530 16:2775660-2775682 GTGGTCCTGGGCCACACTGAGGG - Intronic
1133222175 16:4323485-4323507 GGGGCCCGGAGCCACCAGGATGG + Intronic
1134569492 16:15279308-15279330 GGGGCCCAGAGAACCAATGAGGG - Intergenic
1134732885 16:16476741-16476763 GGGGCCCAGAGAACCAATGAGGG + Intergenic
1134934555 16:18235230-18235252 GGGGCCCAGAGAACCAATGAGGG - Intergenic
1137622140 16:49883128-49883150 GGGGCACAGAGCCCCAATGATGG - Intergenic
1139504261 16:67391264-67391286 GTGGCCCAGGGCGACAGTGACGG - Exonic
1142909256 17:3072978-3073000 GTCCCCCAGAGCCACCATGTGGG + Intergenic
1142925304 17:3231260-3231282 GTCCCCCAGAGCCACCATGTGGG - Intergenic
1143380064 17:6490473-6490495 GGGACCCAGAGTCACAATGATGG + Intronic
1144705123 17:17363139-17363161 CTGACCCAGGGCCACAGTGATGG - Intergenic
1144872835 17:18381287-18381309 GGGGCTCAGGCCCACAATGATGG + Intronic
1145182265 17:20763767-20763789 CTGTCCTAGAGCCAGAATGATGG + Intergenic
1146184073 17:30713577-30713599 GTGGCCCAGAAAGACCATGAAGG - Intergenic
1146540293 17:33687616-33687638 GCCACCCAGAGCCACATTGAAGG - Intronic
1151890184 17:76947058-76947080 GTGGATCTGAGCCACCATGAGGG + Intronic
1152469944 17:80485513-80485535 GTGGCCCAGAGCCGGGGTGAGGG - Intergenic
1153630837 18:7068151-7068173 GTGGCTCAGAGAAACAATGCAGG - Intronic
1153940128 18:9969907-9969929 GGGGCCCTGAACTACAATGAAGG - Intergenic
1155759577 18:29549050-29549072 GTGGCCCAGTGCAACAGTGTTGG + Intergenic
1160354763 18:78217530-78217552 GTGGCCAAGAGACACAATGCAGG - Intergenic
1162341227 19:10092496-10092518 TTGGCACTGAGCCACAAAGAAGG + Exonic
1163369946 19:16896398-16896420 GTGGCCCAGAGCAGCAGCGATGG + Intronic
1164915900 19:32052274-32052296 GTGTCCCAAAGCCACACAGAAGG + Intergenic
1165118886 19:33546381-33546403 GTGTCCCAGAGGGACAATGACGG + Intergenic
1165191240 19:34065638-34065660 TTGGCCCAGTTCCACAAAGAGGG - Intergenic
1165697009 19:37908151-37908173 GTGGCCCAGAGACCCTCTGAGGG + Intronic
1166731458 19:45061309-45061331 GTGGCACAGAGGCACACAGAGGG + Intronic
925844607 2:8024206-8024228 GTCTCCCAGAGACAGAATGAAGG + Intergenic
928757596 2:34545538-34545560 GTGGCCTGGAGCTACAGTGATGG + Intergenic
929481290 2:42310725-42310747 TTGGGCCTGAGCCACCATGATGG - Intronic
929856966 2:45645682-45645704 GTGGCCCAGAGCAAAAGGGAGGG + Intergenic
932332129 2:70903788-70903810 CGGGCCCAGAGCCAGAAGGAGGG - Intronic
932894065 2:75621873-75621895 GAGGCCCAGAACTACAAGGAAGG - Intergenic
933514264 2:83280703-83280725 GAGGCCCAGTGCCAAAATAAGGG - Intergenic
935723181 2:105997625-105997647 ATGGCTCAGAGCGACAAGGATGG + Intergenic
939294302 2:140239501-140239523 GAGGACGAGAGGCACAATGATGG + Exonic
947815662 2:233034647-233034669 CAGGCCCAGAGCACCAATGACGG + Exonic
948805018 2:240450145-240450167 CTGCCCCACAGCCACAATTAGGG - Intronic
948806337 2:240454888-240454910 GTGGCCCCCATCCCCAATGATGG - Intronic
948852051 2:240713277-240713299 GTGGACCAGCGTCACACTGATGG - Intergenic
1172037741 20:32021603-32021625 GTCGCCCAGTGGCACAATCATGG - Intronic
1172572513 20:35981794-35981816 GAAGCCCACAGCCACAATGGAGG + Intronic
1172882367 20:38210328-38210350 CTTGCCCAGTGCCACAGTGAGGG - Intergenic
1175789869 20:61734537-61734559 GGGGCCCAGAGTCACAACCAAGG - Intronic
1176298565 21:5087649-5087671 GTGGCCCAGACCCACAGGGCAGG + Intergenic
1179112150 21:38456597-38456619 GTGGCCCATGCCAACAATGATGG - Intronic
1179233807 21:39527884-39527906 CTGGCCAAGAGCCAGAATGCTGG - Intergenic
1179858461 21:44174300-44174322 GTGGCCCAGACCCACAGGGCAGG - Intergenic
1179919631 21:44500389-44500411 GCCGCCCAGAGCAAGAATGAGGG - Intronic
1181000426 22:19985467-19985489 GGGGCCCAGAGCCCCTATGCTGG - Intronic
1181574223 22:23783614-23783636 GGTGCCCACAGCCACAAAGATGG - Exonic
1181815008 22:25430879-25430901 GGGGCCCACAGCCAGAATCACGG + Intergenic
1182032482 22:27170445-27170467 GTGGCCCAGAGACAGAGAGAGGG + Intergenic
1183653329 22:39171465-39171487 GTGGAGCAGAACCAAAATGAGGG + Intergenic
949612045 3:5712711-5712733 GTGGCCTTGAGCCACAGTGGTGG + Intergenic
950175204 3:10868637-10868659 GTGGCCCAGACCCAGAAGGGTGG - Intronic
950867069 3:16197590-16197612 GTTGCCCTGAGCCACCTTGATGG + Intronic
953003736 3:38958300-38958322 GTGGCCCATGGCCACCATCAGGG - Intergenic
955088035 3:55721874-55721896 GTGGCCCAGAGCCACCTTTCTGG + Intronic
955523349 3:59796263-59796285 GTGGCCCAGAGCCAGGGTAAGGG - Intronic
961514135 3:127422533-127422555 GTGTCCCAGAGGGACAAGGAAGG + Intergenic
961790334 3:129371355-129371377 GTCGCCCAGTGGCACAATCACGG + Intergenic
962248777 3:133821962-133821984 CTGGCCCAAAGCCACAAGAACGG - Intronic
963494177 3:146039275-146039297 GTGGCACAGTGGCACAATCATGG + Intergenic
965401762 3:168220838-168220860 GGGGGCCAGAGCCACAAAGGAGG - Intergenic
966282590 3:178249984-178250006 GTGACACAGAGACACAATGTTGG + Intergenic
967265342 3:187686462-187686484 GTGGCTCAGAGTCACCATCATGG + Intergenic
968969520 4:3786309-3786331 GCAGCCCAGGGCCACAAAGAGGG + Intergenic
969609954 4:8221772-8221794 TTTGCCAGGAGCCACAATGATGG + Intronic
970424422 4:15933186-15933208 GTGGCCAGGAGCCACCATTATGG - Intergenic
971043538 4:22780324-22780346 GCTGACCAGAGCCAAAATGAAGG - Intergenic
972179681 4:36448283-36448305 GTGGCCAAGAGCTACAATTTGGG - Intergenic
976365129 4:84224680-84224702 ATGCCACAGAGCCACAATGTGGG + Intergenic
979717179 4:123853956-123853978 GTGGCCCACAGCCACAAACAAGG - Intergenic
980729626 4:136810391-136810413 GTGGCCCAGACCCAGAAGGCTGG - Intergenic
982418820 4:155169656-155169678 GTCTCCCAAAGCCACAATCAAGG + Intergenic
984812859 4:183810264-183810286 CTGGTCCAGATACACAATGAAGG - Intergenic
985732828 5:1559549-1559571 GTGACCCAGAGCCACGAAGGTGG + Intergenic
989733689 5:44677549-44677571 GTGGCTCAGAGCCCCAAATATGG - Intergenic
991581454 5:68159814-68159836 GTGGACAAGAGCTACATTGAGGG - Intergenic
993589574 5:89778015-89778037 GTGGCCCTGAGCTATAAAGATGG - Intergenic
997511486 5:134457840-134457862 GTGGACCACAGCCACCCTGAAGG + Intergenic
999184275 5:149694041-149694063 GAGGCCCAGAGCCATGATCATGG + Intergenic
999278121 5:150345949-150345971 CTGGCACAGAGCCATAATGGGGG - Intergenic
999857555 5:155611394-155611416 GTTGCCCTGAGCAACAATAAAGG - Intergenic
1001654717 5:173340667-173340689 GTGGCCCAGAGCCACGGAGGAGG - Intergenic
1002519987 5:179787094-179787116 GTGAGCCAGAGCCACGATGCTGG - Intronic
1003212852 6:4082590-4082612 GTGGCCCATACCCAGAAGGAAGG + Intronic
1003293540 6:4803648-4803670 GGGACACAGAGCCACAGTGACGG - Intronic
1006414890 6:33897709-33897731 CTGGCCCGCAGCCACAATAAGGG + Intergenic
1006510465 6:34518535-34518557 GTGGCCCACAGAAACACTGAGGG + Intronic
1006627134 6:35405413-35405435 AGGGCCCTGAGCCAGAATGAGGG - Intronic
1008693928 6:54012013-54012035 ATGGCCCAGAACCAAAATAAGGG + Intronic
1010165419 6:72909546-72909568 CTGGACCAGAGCCTCAATGCAGG - Intronic
1011321909 6:86104823-86104845 GTGGCCCAGAGTCCCAATCTAGG + Intergenic
1020257377 7:6509623-6509645 AGGGCCCAGAGCCACAGTCATGG + Intronic
1020763185 7:12292035-12292057 CTGTCCCAGAGCCATAAGGATGG - Intergenic
1023871503 7:44265440-44265462 GTGGGCCAGAGCCAGGCTGAGGG + Intronic
1023912289 7:44564556-44564578 GTATCCCAGAGCCACCCTGATGG - Intergenic
1023960430 7:44921888-44921910 TTGAGCCAGAGCCACAAAGAGGG + Intergenic
1029793596 7:102871155-102871177 GTGGCCAAGATCCTCAAGGAGGG - Intronic
1032871428 7:135990162-135990184 GTGGACAAGAGCTACAATGTTGG - Intergenic
1033989386 7:147265281-147265303 GTGGCCTGGAGCTACAGTGATGG - Intronic
1034050788 7:147982481-147982503 GTGACCCAGAGAGACAAGGAAGG + Intronic
1034116985 7:148592097-148592119 GGGGCACTGTGCCACAATGAGGG - Intronic
1035457534 7:159018418-159018440 GTGAGACAGAGACACAATGAGGG - Intergenic
1035457588 7:159018691-159018713 GTGAGACAGAGACACAATGAGGG - Intergenic
1036645538 8:10609639-10609661 GCCGCCCGGAGCCACCATGATGG - Exonic
1037605428 8:20433980-20434002 GTGGGACAGAGCCACATTGAAGG - Intergenic
1038531481 8:28321391-28321413 GTGGCCCAGAACCAGGAAGATGG + Intronic
1039214563 8:35255335-35255357 GTGGCCTTGAGTCACTATGATGG - Intronic
1040504055 8:48030987-48031009 GTGGCCCAGAGCCACAATGAAGG - Intronic
1041260510 8:56017322-56017344 ATGGCCCAGAGCCACACTGCTGG + Intergenic
1041738149 8:61132897-61132919 CTGGCACAGAGCAGCAATGATGG - Intronic
1045298065 8:100889464-100889486 GAGGCCCACAGGCACTATGAGGG + Intergenic
1046225190 8:111269211-111269233 GTTTCCCATAGACACAATGAAGG + Intergenic
1048845423 8:138600360-138600382 GTGACCCAGAGCCACAGAAAAGG + Intronic
1055939723 9:81637924-81637946 AGGGCTCAGAGCCAGAATGAGGG + Intronic
1056424791 9:86465484-86465506 GTGGCCCAGAGACACCAGGCTGG - Intergenic
1056793846 9:89643035-89643057 GTGGCCGACAGCCAGTATGAGGG + Intergenic
1059405100 9:114094467-114094489 GAGGCCCAGAGCCACCTTTATGG + Intronic
1062210950 9:135363724-135363746 GTGCCACATAGCAACAATGACGG + Intergenic
1186918577 X:14250880-14250902 ATAGCCAAGAGCCACAATGATGG - Intergenic
1187968075 X:24632302-24632324 GTGACCAAGAGCCAGAAGGATGG + Intronic
1192381869 X:70625646-70625668 GTAGGCCACAGCAACAATGAAGG - Intronic
1196381774 X:115098712-115098734 GCAGCCTAGAGCTACAATGATGG - Intergenic
1200239817 X:154487573-154487595 GCCGCTCAGCGCCACAATGAAGG + Exonic
1201068851 Y:10126092-10126114 GTGGCCCAGAGGCACAAACTGGG - Intergenic