ID: 1040506815

View in Genome Browser
Species Human (GRCh38)
Location 8:48056561-48056583
Sequence CAAAAAAAGGAAAAGGAGAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040506810_1040506815 27 Left 1040506810 8:48056511-48056533 CCCAAATAAAAAGCAAGAAATTA 0: 2
1: 2
2: 21
3: 187
4: 2033
Right 1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG No data
1040506809_1040506815 28 Left 1040506809 8:48056510-48056532 CCCCAAATAAAAAGCAAGAAATT 0: 2
1: 3
2: 20
3: 136
4: 1381
Right 1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG No data
1040506811_1040506815 26 Left 1040506811 8:48056512-48056534 CCAAATAAAAAGCAAGAAATTAA 0: 1
1: 2
2: 8
3: 128
4: 1416
Right 1040506815 8:48056561-48056583 CAAAAAAAGGAAAAGGAGACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040506815 Original CRISPR CAAAAAAAGGAAAAGGAGAC AGG Intronic
No off target data available for this crispr