ID: 1040507060

View in Genome Browser
Species Human (GRCh38)
Location 8:48058424-48058446
Sequence GGCGCACACCACCACAGGCC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 259
Summary {0: 1, 1: 0, 2: 4, 3: 38, 4: 216}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040507060_1040507073 30 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507073 8:48058477-48058499 GGGAGGATCACCTGAGCCCAGGG 0: 340
1: 1133
2: 2541
3: 5116
4: 7941
1040507060_1040507070 10 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507070 8:48058457-48058479 GCAACTTGGGAGGCTGAGGTGGG 0: 159
1: 14788
2: 144024
3: 353817
4: 467202
1040507060_1040507063 -3 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507063 8:48058444-48058466 GCCTGTAGTCCCAGCAACTTGGG 0: 181
1: 31692
2: 167163
3: 500122
4: 491638
1040507060_1040507067 6 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507067 8:48058453-48058475 CCCAGCAACTTGGGAGGCTGAGG 0: 697
1: 94425
2: 299617
3: 460481
4: 390550
1040507060_1040507072 29 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507072 8:48058476-48058498 TGGGAGGATCACCTGAGCCCAGG 0: 1640
1: 12067
2: 32810
3: 87682
4: 158958
1040507060_1040507062 -4 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507062 8:48058443-48058465 CGCCTGTAGTCCCAGCAACTTGG 0: 178
1: 43798
2: 112981
3: 316420
4: 417735
1040507060_1040507071 13 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507071 8:48058460-48058482 ACTTGGGAGGCTGAGGTGGGAGG 0: 8282
1: 20265
2: 64844
3: 127749
4: 200926
1040507060_1040507069 9 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507069 8:48058456-48058478 AGCAACTTGGGAGGCTGAGGTGG 0: 183
1: 14814
2: 96894
3: 197700
4: 194408
1040507060_1040507065 0 Left 1040507060 8:48058424-48058446 CCGGGCCTGTGGTGGTGTGCGCC 0: 1
1: 0
2: 4
3: 38
4: 216
Right 1040507065 8:48058447-48058469 TGTAGTCCCAGCAACTTGGGAGG 0: 285
1: 43590
2: 168514
3: 544677
4: 477977

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040507060 Original CRISPR GGCGCACACCACCACAGGCC CGG (reversed) Intronic
900587468 1:3440089-3440111 GGGGCACAGCTCCAGAGGCCCGG - Intergenic
902180454 1:14684466-14684488 GTGGCACATCACCACAAGCCAGG + Intronic
902298207 1:15482928-15482950 AGTGCCCACCACCACAGGCCCGG + Intronic
902577517 1:17387607-17387629 GGCACCTACCACCACACGCCTGG - Intronic
903608234 1:24590750-24590772 GGCACACACCACCACCAGGCTGG + Intronic
906086458 1:43139259-43139281 GAAGCACAGCACCACAGGCAGGG - Intergenic
906594649 1:47064224-47064246 AGGGCACACCACCACACGCCTGG + Intergenic
907032794 1:51188780-51188802 GGCACACACCACCAGACCCCAGG - Intergenic
907487517 1:54787895-54787917 ACCCCCCACCACCACAGGCCTGG - Intronic
907635813 1:56133916-56133938 GGCCCACACCACCACATCACTGG + Intergenic
908419574 1:63946862-63946884 GGTGGATACCACCACATGCCTGG + Intronic
910136705 1:83980407-83980429 GGCGCACACCACCATGGGCCTGG + Intronic
911490460 1:98558983-98559005 CCCGCACCCCACAACAGGCCCGG - Intergenic
912057488 1:105622910-105622932 GCCCCACACTACCACAGTCCAGG - Intergenic
915273942 1:154775248-154775270 CGCCCACACCACACCAGGCCTGG - Intronic
915730966 1:158054066-158054088 GGCACACACCACCACACACCTGG - Intronic
916024919 1:160825061-160825083 GGTGTGTACCACCACAGGCCTGG - Intronic
916585675 1:166147774-166147796 GGTGCACACCACCATACCCCAGG + Intronic
916707323 1:167364717-167364739 GGCGCACACCACCACACACCTGG + Intronic
918031706 1:180819873-180819895 GGCACACACCACCACACCCAGGG - Intronic
919391726 1:196993437-196993459 GGCGCCCACCACCCCATGCCTGG + Intronic
919796957 1:201326686-201326708 GGCCCACACCACCTCCAGCCTGG - Intronic
920186533 1:204162736-204162758 GGTCCACTCCACCACAGCCCTGG - Intronic
922763335 1:228145523-228145545 CCCGCTCAGCACCACAGGCCTGG - Exonic
922791727 1:228314632-228314654 GGGGCCCACCACGACAGCCCAGG - Intronic
924230892 1:241960824-241960846 GGTGCACACCACACCACGCCCGG - Intergenic
1062934728 10:1377221-1377243 GGCGCACACAAACACACCCCAGG - Intronic
1065818581 10:29505179-29505201 GGCGCCCGCCACCACACCCCAGG - Intronic
1066511001 10:36095721-36095743 GGCTCACAATTCCACAGGCCAGG - Intergenic
1067794631 10:49311792-49311814 GGCACAGGGCACCACAGGCCTGG + Intronic
1068860813 10:61846086-61846108 GGCCAACACCAGCACAGGGCTGG + Intergenic
1069741795 10:70689616-70689638 GGCTCACACCACCCCAGTGCTGG - Intronic
1069942510 10:71964951-71964973 TGCGCACACCCACACCGGCCAGG + Intronic
1070591757 10:77806724-77806746 GCCCCACCCCACCCCAGGCCCGG + Intronic
1071401821 10:85280482-85280504 TGCCTACACCACCACAGCCCTGG - Intergenic
1072505572 10:96062876-96062898 GGCATACACCACCACATGCCTGG + Intergenic
1072594986 10:96863023-96863045 GGCACCCACCACCACATGCCCGG + Intronic
1072898589 10:99388084-99388106 GGCTCACACCACCTGAGCCCTGG + Intronic
1072995358 10:100238785-100238807 GGCACATGCCATCACAGGCCTGG - Intronic
1075664562 10:124221341-124221363 GGAGGACACAAACACAGGCCTGG - Intergenic
1077415575 11:2422884-2422906 GGCGGACATCACCTGAGGCCTGG + Intronic
1079616940 11:22506771-22506793 GGCGCCCGCCACCACGCGCCTGG + Intergenic
1079656158 11:22988436-22988458 AGCCCCCACCATCACAGGCCTGG - Intergenic
1080541840 11:33273362-33273384 GGTGCCCGCCACCACACGCCTGG - Intronic
1084004455 11:66315663-66315685 GGCAGAGACCACCACAGGCCGGG + Exonic
1084481134 11:69420831-69420853 GGCCCACATCCCCACAGGCCTGG - Intergenic
1086033585 11:82389252-82389274 GCCGCTCACCACCACCTGCCTGG - Intergenic
1088797081 11:113273440-113273462 GGCTCCCAGCACCAAAGGCCCGG + Intronic
1090389700 11:126381076-126381098 GCAGGACAGCACCACAGGCCCGG - Intronic
1091700774 12:2660135-2660157 GGTGGACACAACCACAGGTCAGG - Intronic
1093177200 12:15925963-15925985 GGCGCCCACCATCACACACCCGG + Intronic
1093472966 12:19524377-19524399 GGCGCAAACCACCTGAGGTCAGG - Intronic
1094349550 12:29508716-29508738 GGCGTGCACCACAACATGCCCGG + Intronic
1095160061 12:38905563-38905585 GGCGCCCACAACCACAGCTCGGG + Exonic
1096105661 12:48995845-48995867 AGCTCAGACCACCACAGGCCAGG + Exonic
1096365505 12:51025971-51025993 AGCGCACCCCGACACAGGCCGGG + Intronic
1103918247 12:124386814-124386836 GGCACACACAGGCACAGGCCAGG + Intronic
1104288230 12:127444892-127444914 GGTGCACACCACCACAAACCTGG + Intergenic
1104967921 12:132517668-132517690 GGCACACGCCACCAGAGGCCTGG - Intronic
1106062104 13:26303527-26303549 GGCTCACACCACCTGAGGTCAGG - Intronic
1108336415 13:49445784-49445806 GGGGCCCGCCACCACACGCCCGG - Intronic
1111668716 13:91301789-91301811 GGCACTCACCACCACATGCCTGG + Intergenic
1112488582 13:99841958-99841980 GGTGCACACCACCACACCCAGGG + Intronic
1115687286 14:35809144-35809166 GCCGCTCGCCGCCACAGGCCGGG + Exonic
1118417046 14:65551131-65551153 GGCTCATAGCACAACAGGCCAGG + Intronic
1119736477 14:76985886-76985908 GGCTCTCACCAGCACAGCCCAGG + Intergenic
1122371404 14:101230671-101230693 GGTGGGCACCACCACAGCCCAGG - Intergenic
1122562835 14:102629036-102629058 GGCGTGCGCCACCACATGCCTGG + Intronic
1124258879 15:28168607-28168629 GGGGCAGCTCACCACAGGCCTGG - Intronic
1124566798 15:30823558-30823580 GGGGCAGCTCACCACAGGCCTGG + Intergenic
1125921719 15:43529121-43529143 GGTACTCACCACCCCAGGCCTGG + Exonic
1126407115 15:48332298-48332320 GCCGCCCACCTCCGCAGGCCGGG - Exonic
1127012048 15:54641968-54641990 GGCCCACACCACCAGAGCCTTGG + Intergenic
1128258300 15:66214260-66214282 GGCGCAGACCACCTGAGGTCAGG - Intronic
1129063310 15:72879465-72879487 GGCGTGCACCACCACACGCCTGG + Intergenic
1129293760 15:74588096-74588118 GGCACACACCACCACACTCAGGG - Intronic
1130513893 15:84611150-84611172 GGTGCACACCACCACATGCCCGG - Intronic
1131150289 15:90043330-90043352 TGTGCACAGCATCACAGGCCAGG + Intronic
1131181387 15:90242230-90242252 GGCGTGCACCACCACACACCTGG + Exonic
1132124050 15:99204778-99204800 GGTGCACACCACCACACACCTGG + Intronic
1132663730 16:1072617-1072639 GGCGCACTCGCCCACAGCCCTGG - Intergenic
1133810003 16:9154512-9154534 GGCGCACAGAACCAGAGGGCGGG + Intergenic
1137448688 16:48550368-48550390 GGCATGTACCACCACAGGCCTGG - Intronic
1138484952 16:57334520-57334542 GGCATGCACCACCACATGCCCGG + Intergenic
1139512380 16:67434882-67434904 GGTGCGCATCACCACAGGCCTGG - Intronic
1139961742 16:70721928-70721950 GGAGCACAGGACCCCAGGCCCGG + Intronic
1142834020 17:2571244-2571266 GGTGTGCACCACCACATGCCTGG - Intergenic
1144385402 17:14744767-14744789 TGAGCACACCACCACAAGCAAGG + Intergenic
1144482953 17:15642678-15642700 GTCCCACACCCTCACAGGCCTGG + Intronic
1144915729 17:18722353-18722375 GTCCCACACCCTCACAGGCCTGG - Intronic
1145214526 17:21042280-21042302 GGAGAACACCACCCCCGGCCCGG + Intronic
1146062192 17:29613298-29613320 GGCGCACCCACCCACCGGCCGGG - Intronic
1146739536 17:35270492-35270514 GGCTGGCACCACCACAGGCCAGG + Exonic
1147661630 17:42120069-42120091 GGACCCCTCCACCACAGGCCGGG + Exonic
1150768461 17:68021080-68021102 GGCGCACGCCACCAAACGCCTGG - Intergenic
1152919629 17:83059478-83059500 GTCCCACACCAGGACAGGCCTGG + Intergenic
1153188515 18:2512529-2512551 GGCACACACCACCACACACCTGG + Intergenic
1153398016 18:4647005-4647027 GGCGCCCACCACCACACCCGGGG - Intergenic
1159062462 18:63530299-63530321 AGACCACACCACCATAGGCCTGG + Intergenic
1159939096 18:74392474-74392496 GGCTCAGACCACCACAGGAGCGG - Intergenic
1160030814 18:75258012-75258034 GGAGCACTGCTCCACAGGCCGGG - Intronic
1160806496 19:994417-994439 GGCCCCCACCAGCCCAGGCCTGG + Exonic
1161253338 19:3293190-3293212 CGTGCACACCTGCACAGGCCAGG - Intronic
1161608332 19:5227189-5227211 GACGTGCACCACCACATGCCTGG + Intronic
1161683759 19:5693239-5693261 GGCCCACACCACCACGGGACAGG - Intronic
1163149444 19:15402330-15402352 AGCCCACACCCCTACAGGCCTGG + Intronic
1163590546 19:18191654-18191676 GGCGCCCACCACCACGCCCCTGG + Intergenic
1164224030 19:23225994-23226016 GGCGCACCCCACCCCATGCCTGG + Intronic
1164644450 19:29847990-29848012 GGTGCACACCACCACACCCCCGG - Intergenic
1164764570 19:30754188-30754210 GGCACAACCCACCACAGGCCAGG + Intergenic
1165852785 19:38859981-38860003 GGAGCACAGCACCACAGGGAGGG + Intergenic
1166516992 19:43454525-43454547 GGCGCGTGCCACCACACGCCTGG + Intergenic
1166596729 19:44056736-44056758 GGCGCCCGCCACCACACACCCGG + Intronic
1166753778 19:45178362-45178384 CGCGCACACCACCTGAGTCCGGG - Intronic
1167314138 19:48754039-48754061 GGCGCCCTCCACCACGCGCCCGG - Intronic
1167358093 19:49016260-49016282 GGTGCACACCACCTGAGGCAGGG + Exonic
1167610729 19:50506649-50506671 GGCCCTCACCACCACCAGCCTGG - Intronic
925386416 2:3464889-3464911 GGGCCAGACCACCACAGGCAGGG + Intronic
926086056 2:10021054-10021076 GGCACCCACCACCACAAGCCTGG + Intergenic
927585412 2:24299173-24299195 GGCACACACCACCACACACCTGG + Intronic
930124874 2:47787759-47787781 AGTGCACACCACCCCATGCCTGG + Intronic
933786793 2:85849468-85849490 GGTGCCCACCACCACGTGCCCGG - Intronic
935147201 2:100403949-100403971 GGCCTACACCACCCCAGCCCAGG + Intronic
938771732 2:134506686-134506708 TGCTCACACCACCACTGCCCTGG + Intronic
941727421 2:168877849-168877871 GGCACACACCACATCACGCCTGG + Intronic
942169380 2:173275067-173275089 GGAGGAAACCAACACAGGCCTGG - Intergenic
943127596 2:183814773-183814795 GGTGCCCACCACCCCATGCCTGG - Intergenic
943893496 2:193322161-193322183 GGCGCCCACCACCACACCCCTGG + Intergenic
944155480 2:196603005-196603027 GGCACCCACCGCCACACGCCTGG - Intergenic
944667223 2:201968149-201968171 TGTGCACACCAGAACAGGCCGGG + Intergenic
945910494 2:215643629-215643651 GGTGCCCACCACCACATGCCCGG + Intergenic
946240907 2:218355057-218355079 GGAGCACAGCACCACAGGGAGGG - Intergenic
946442305 2:219706947-219706969 GGCACACACCAGGCCAGGCCAGG - Intergenic
947428979 2:230009187-230009209 GGGGCACAGCACAACAGGGCTGG + Intronic
948154465 2:235770275-235770297 GACGCACGCCACCCCACGCCTGG + Intronic
948181292 2:235983062-235983084 TGAGCACACCTCCACAGACCAGG - Intronic
948190060 2:236051551-236051573 GGCACACCTCCCCACAGGCCCGG - Intronic
1169207433 20:3748330-3748352 GGCGCCCACCACCTGGGGCCCGG - Exonic
1170194355 20:13675011-13675033 GGTGCCCACCACCACACACCTGG - Intergenic
1171459553 20:25291070-25291092 GGCCCACAACCCCACTGGCCTGG - Intronic
1172261677 20:33572033-33572055 GGCGCCTGCCACCACGGGCCTGG + Intronic
1172383536 20:34516493-34516515 GCCGCCCACCACCCCACGCCAGG + Intronic
1173622219 20:44445348-44445370 GGTGCCCACCACCCCATGCCTGG - Intergenic
1173985643 20:47259518-47259540 GGCGCCAACCACCAAAGGCGTGG + Intronic
1174064608 20:47855397-47855419 GGGGCACATCACCAGAGGTCAGG + Intergenic
1175214615 20:57385280-57385302 GTCACAAACTACCACAGGCCGGG - Intergenic
1175226626 20:57448244-57448266 AGTGCACACGTCCACAGGCCTGG + Intergenic
1175846655 20:62063389-62063411 GGCACGCGTCACCACAGGCCGGG + Intronic
1176148404 20:63575694-63575716 GGCACACACCACCACAGTACAGG + Intergenic
1179537321 21:42060978-42061000 CGCCCACACCAGCACAGGCCAGG - Intergenic
1180880714 22:19201776-19201798 GGAGCACACCTCCTCAGCCCAGG - Intronic
1181066576 22:20309239-20309261 GGTGCAGGCGACCACAGGCCTGG + Intergenic
1181307704 22:21926488-21926510 GGACCACAACACCCCAGGCCTGG + Intronic
1183488736 22:38105482-38105504 GGCGCCCGCCACCACATGCGCGG + Intronic
1183716289 22:39535370-39535392 GGCGCAGACCCACCCAGGCCCGG - Intergenic
1184021621 22:41825368-41825390 GGCTGAGACCACCACAGACCCGG - Intronic
1184694621 22:46132618-46132640 GGCGCTGGCCAGCACAGGCCAGG - Intergenic
1184788174 22:46682000-46682022 AGCTCACACCAACACAGGACGGG - Intergenic
1185292497 22:50034241-50034263 GGCCCACAGCACCACAGGGAAGG - Intronic
950678321 3:14568086-14568108 GGGGCAGACCACCAAGGGCCAGG + Intergenic
954133938 3:48573442-48573464 GGCGCACACTACCCCAGGCATGG + Intronic
961173407 3:124815261-124815283 GGCGCACAGCTCCATAGACCTGG - Intronic
961700085 3:128737180-128737202 GGCGCCCGCCACCACACACCTGG + Intronic
962809735 3:138949988-138950010 GGCGCTCACCTCCAAAGGCCAGG + Intronic
963141927 3:141953377-141953399 GGCTCTCAACACCACAGTCCAGG - Intronic
964258731 3:154810210-154810232 CCCGCACGCCACAACAGGCCTGG - Intergenic
966849792 3:184157138-184157160 GGAGCACCCCACCCCAGGGCAGG - Intronic
968322162 3:197779677-197779699 GGCACACACCACCACACCCAGGG + Intronic
968481070 4:833350-833372 GGCCCACAGCTCCACAGGCCTGG + Intergenic
968574929 4:1361207-1361229 GGACCACAGCACCACAGGCCTGG - Intronic
968689758 4:1984430-1984452 GGCTCACAGCACCTCAGGCCAGG - Intronic
968950259 4:3687827-3687849 GGCTCACGCCACCACCTGCCTGG - Intergenic
970407164 4:15774794-15774816 GGCACGCACCACCATGGGCCTGG - Intergenic
971706439 4:30049228-30049250 CCCTCACCCCACCACAGGCCCGG - Intergenic
974028414 4:56754452-56754474 GGCGTGCACCACCACATCCCCGG - Intergenic
975672031 4:76789698-76789720 GGCACCCGCCACTACAGGCCTGG - Intergenic
981468738 4:145103904-145103926 GGCGCACACCACCACATGTCTGG + Intronic
984269883 4:177537235-177537257 TGCCTACACCACCACAGCCCTGG - Intergenic
984916990 4:184733939-184733961 GGCGCAAACCACGGCAGGCGAGG + Intronic
985579755 5:690399-690421 GGCGCTGACCAGCACTGGCCTGG + Intronic
985594601 5:782458-782480 GGCGCTGACCAGCACTGGCCTGG + Intergenic
986331751 5:6721594-6721616 AGTGCACACCACCAGAGTCCAGG - Intronic
987100334 5:14585564-14585586 AGAGCACACCACTCCAGGCCAGG - Intronic
991983135 5:72254347-72254369 TGTGCACACCACCACACACCAGG - Intronic
992427365 5:76671541-76671563 GGTGTGCACCACCACATGCCCGG - Intronic
994660052 5:102642228-102642250 GGCCACCACCACCACTGGCCCGG - Intergenic
997471168 5:134117707-134117729 GAGGCACACCACCACTGGCCTGG + Intronic
1001009559 5:168085682-168085704 GGCGCACTTTGCCACAGGCCTGG + Intronic
1001670668 5:173470696-173470718 CCAGCACACCACCACAGGACAGG - Intergenic
1002339410 5:178505131-178505153 CGAGCACACCACCAGAAGCCAGG - Intronic
1003138971 6:3456124-3456146 AGGGGTCACCACCACAGGCCGGG - Exonic
1003282845 6:4709338-4709360 GGCACTCACCACCCCATGCCCGG + Intronic
1003298830 6:4858356-4858378 GGCGAACACAAACACAGTCCTGG + Intronic
1004436063 6:15595407-15595429 GCCACCCACCACCACATGCCTGG + Intronic
1006093883 6:31644121-31644143 GGCCCACTCCTCCACAGGCTCGG - Exonic
1006401223 6:33818704-33818726 GGTTCACACAACCCCAGGCCTGG - Intergenic
1007673457 6:43575885-43575907 AGCGCACACCACTGCAGTCCCGG + Exonic
1008891192 6:56492822-56492844 AGATCACACCACCACAGTCCTGG + Intronic
1009966891 6:70587345-70587367 GGCGCACACCACTATGTGCCTGG - Intronic
1011223553 6:85083212-85083234 GGCGCCCACCATCACGCGCCCGG - Intergenic
1011982596 6:93401053-93401075 GGCTACCATCACCACAGGCCAGG + Intronic
1012419266 6:99044931-99044953 GGCGCACACCACCAAAATCGTGG + Intergenic
1012748087 6:103120544-103120566 GGCACATGCCACCACATGCCTGG + Intergenic
1016875290 6:148858650-148858672 GCCCCACCCCACAACAGGCCCGG + Intronic
1017019110 6:150126087-150126109 GACGCATACCACCAGACGCCAGG + Intergenic
1017708963 6:157148736-157148758 GGGGCACAGCACCACATGGCTGG - Exonic
1018293473 6:162317420-162317442 GACTCACACCTCCACATGCCTGG - Intronic
1018326462 6:162675190-162675212 GGCACGCACCACCACACGCCTGG + Intronic
1019307345 7:342080-342102 GACTCACACCCCCACCGGCCAGG - Intergenic
1019415036 7:923187-923209 GGAACACAGCACCACATGCCCGG - Intronic
1019434744 7:1016660-1016682 AGCGCACAGCAGCACACGCCAGG + Intronic
1020009205 7:4799347-4799369 CGAGGACACCCCCACAGGCCCGG - Exonic
1020164880 7:5799951-5799973 GGCGCAGACCACCTGAGGTCAGG - Intergenic
1022090949 7:27108009-27108031 AGCGGCCACCACCACGGGCCGGG - Exonic
1023960503 7:44922200-44922222 GGGACACCCCACCCCAGGCCTGG + Intergenic
1024283753 7:47739552-47739574 GGAGGACACCACATCAGGCCTGG - Intronic
1025166190 7:56714405-56714427 GGCATACACCACCCCATGCCTGG - Intergenic
1026159750 7:67858346-67858368 GGCGCCCACCACCACACACTTGG + Intergenic
1026352214 7:69527280-69527302 GGCACACGCCACCACACACCTGG + Intergenic
1026937528 7:74267121-74267143 GGCGCACACCACCACCAGGCCGG + Intergenic
1027235827 7:76297260-76297282 GGCGTGCACCACCACGGGCTGGG - Intergenic
1030583907 7:111392924-111392946 GGCGAACACATCCACATGCCAGG - Intronic
1031492379 7:122404982-122405004 GGCGCCCGCCACCACACACCTGG - Intronic
1031900322 7:127402007-127402029 GGCACACACCACCACCTCCCTGG - Intronic
1031979002 7:128112393-128112415 GGCGCACAGCAGCACCAGCCAGG + Intergenic
1034093115 7:148382203-148382225 TGCTCACAGCCCCACAGGCCTGG + Intronic
1034982661 7:155488742-155488764 GGGACACCCCACCCCAGGCCTGG + Intronic
1037725281 8:21478270-21478292 GGCACACAGCACCTCAGCCCTGG - Intergenic
1039517780 8:38147790-38147812 GGCTCACCCTACAACAGGCCTGG - Intronic
1039800018 8:40946198-40946220 GGTGCACCCCCACACAGGCCAGG + Intergenic
1040507060 8:48058424-48058446 GGCGCACACCACCACAGGCCCGG - Intronic
1040929730 8:52721137-52721159 GGCGTATGCCACCACATGCCTGG - Intronic
1041043105 8:53866522-53866544 GGCACCCACCATCACACGCCTGG + Intronic
1048641847 8:136371925-136371947 GGTGCACACCACCACACCCACGG + Intergenic
1048776668 8:137954274-137954296 GGCTCACAGCTCCACAGGGCTGG + Intergenic
1049588273 8:143441754-143441776 GGCGCCCTGCACCACAGGCCAGG - Intronic
1049641985 8:143719958-143719980 GGCGCCCACCTCCACGGCCCAGG - Intronic
1056366380 9:85909137-85909159 GGCACACGCCACCATATGCCTGG - Intergenic
1057554215 9:96074613-96074635 GGCACCCACCACCACGGGCCTGG + Intergenic
1057560557 9:96124961-96124983 GGGGCAGAACACCCCAGGCCCGG + Intergenic
1058492742 9:105519802-105519824 GCCGCTCGCCGCCACAGGCCGGG - Intronic
1060402634 9:123357314-123357336 TGCCCCCACCACCACAGGCTGGG + Intronic
1060438183 9:123614335-123614357 AGCGCTCAGCATCACAGGCCTGG - Intronic
1060730736 9:126035264-126035286 GGCACATACCAACACACGCCTGG + Intergenic
1060964672 9:127705935-127705957 AGGGCAGACCACCACAGGCGAGG + Intronic
1061970346 9:134041582-134041604 GGCTCGCACCACCCCAGACCTGG + Intronic
1062369325 9:136229365-136229387 GGCGGACCCCTCCACAGCCCCGG + Intronic
1062480064 9:136746937-136746959 GGCGCACCCGACCACATGCATGG - Intronic
1185485615 X:479360-479382 GGCACGCGCCACCACACGCCCGG - Intergenic
1185854235 X:3519436-3519458 GGCGCAAACCATCATATGCCTGG + Intergenic
1187145414 X:16632564-16632586 GGCACACACCACACCATGCCCGG + Intronic
1188673111 X:32904716-32904738 GGCATCCACCACCACACGCCCGG + Intronic
1188812684 X:34671146-34671168 GGTGCAAATCACCAAAGGCCTGG + Intergenic
1190759321 X:53426537-53426559 GGCACCCACCCCTACAGGCCTGG + Intronic
1193121273 X:77824981-77825003 GGCAAACACCACCCCACGCCTGG - Intergenic
1193624079 X:83794953-83794975 AGCTCACACAACCCCAGGCCAGG + Intergenic
1199684186 X:150251457-150251479 GCCCCACCCCACAACAGGCCCGG - Intergenic
1200705927 Y:6442401-6442423 GGGGCACTCCACCACAGTCTTGG - Intergenic
1201028183 Y:9722307-9722329 GGGGCACTCCACCACAGTCTTGG + Intergenic