ID: 1040510021

View in Genome Browser
Species Human (GRCh38)
Location 8:48085070-48085092
Sequence AAGGAGAAGCTGGGTGAGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040510011_1040510021 8 Left 1040510011 8:48085039-48085061 CCCTCCTGGGTCTGAGTTTCTGA No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510006_1040510021 22 Left 1040510006 8:48085025-48085047 CCTGGTGAGGAGCCCCCTCCTGG No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510009_1040510021 10 Left 1040510009 8:48085037-48085059 CCCCCTCCTGGGTCTGAGTTTCT No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510005_1040510021 29 Left 1040510005 8:48085018-48085040 CCGGGGTCCTGGTGAGGAGCCCC No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510012_1040510021 7 Left 1040510012 8:48085040-48085062 CCTCCTGGGTCTGAGTTTCTGAG No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510013_1040510021 4 Left 1040510013 8:48085043-48085065 CCTGGGTCTGAGTTTCTGAGAGG No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510010_1040510021 9 Left 1040510010 8:48085038-48085060 CCCCTCCTGGGTCTGAGTTTCTG No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data
1040510004_1040510021 30 Left 1040510004 8:48085017-48085039 CCCGGGGTCCTGGTGAGGAGCCC No data
Right 1040510021 8:48085070-48085092 AAGGAGAAGCTGGGTGAGGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040510021 Original CRISPR AAGGAGAAGCTGGGTGAGGC TGG Intergenic
No off target data available for this crispr