ID: 1040514528

View in Genome Browser
Species Human (GRCh38)
Location 8:48124153-48124175
Sequence GAAACTCTCTCAGGACACTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514528_1040514535 9 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514535 8:48124185-48124207 GGTTTGGTCCCCAGAGCCACAGG No data
1040514528_1040514533 -7 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514533 8:48124169-48124191 GAGTTTCCGGTCTGTGGGTTTGG No data
1040514528_1040514538 18 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514538 8:48124194-48124216 CCCAGAGCCACAGGTGCTGCTGG No data
1040514528_1040514540 19 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514528 Original CRISPR GAAACTCTCTCAGGACACTC TGG (reversed) Intergenic
No off target data available for this crispr