ID: 1040514530

View in Genome Browser
Species Human (GRCh38)
Location 8:48124162-48124184
Sequence CACAGACCGGAAACTCTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514530_1040514535 0 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514535 8:48124185-48124207 GGTTTGGTCCCCAGAGCCACAGG No data
1040514530_1040514542 30 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514530_1040514538 9 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514538 8:48124194-48124216 CCCAGAGCCACAGGTGCTGCTGG No data
1040514530_1040514540 10 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514530 Original CRISPR CACAGACCGGAAACTCTCTC AGG (reversed) Intergenic
No off target data available for this crispr