ID: 1040514532

View in Genome Browser
Species Human (GRCh38)
Location 8:48124164-48124186
Sequence TGAGAGAGTTTCCGGTCTGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514526_1040514532 -6 Left 1040514526 8:48124147-48124169 CCAGACCCAGAGTGTCCTGAGAG No data
Right 1040514532 8:48124164-48124186 TGAGAGAGTTTCCGGTCTGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514532 Original CRISPR TGAGAGAGTTTCCGGTCTGT GGG Intergenic
No off target data available for this crispr