ID: 1040514533

View in Genome Browser
Species Human (GRCh38)
Location 8:48124169-48124191
Sequence GAGTTTCCGGTCTGTGGGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514527_1040514533 -6 Left 1040514527 8:48124152-48124174 CCCAGAGTGTCCTGAGAGAGTTT No data
Right 1040514533 8:48124169-48124191 GAGTTTCCGGTCTGTGGGTTTGG No data
1040514526_1040514533 -1 Left 1040514526 8:48124147-48124169 CCAGACCCAGAGTGTCCTGAGAG No data
Right 1040514533 8:48124169-48124191 GAGTTTCCGGTCTGTGGGTTTGG No data
1040514528_1040514533 -7 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514533 8:48124169-48124191 GAGTTTCCGGTCTGTGGGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514533 Original CRISPR GAGTTTCCGGTCTGTGGGTT TGG Intergenic
No off target data available for this crispr