ID: 1040514534

View in Genome Browser
Species Human (GRCh38)
Location 8:48124175-48124197
Sequence TGGGGACCAAACCCACAGAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514534_1040514538 -4 Left 1040514534 8:48124175-48124197 CCGGTCTGTGGGTTTGGTCCCCA No data
Right 1040514538 8:48124194-48124216 CCCAGAGCCACAGGTGCTGCTGG No data
1040514534_1040514540 -3 Left 1040514534 8:48124175-48124197 CCGGTCTGTGGGTTTGGTCCCCA No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
1040514534_1040514542 17 Left 1040514534 8:48124175-48124197 CCGGTCTGTGGGTTTGGTCCCCA No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514534 Original CRISPR TGGGGACCAAACCCACAGAC CGG (reversed) Intergenic
No off target data available for this crispr