ID: 1040514540

View in Genome Browser
Species Human (GRCh38)
Location 8:48124195-48124217
Sequence CCAGAGCCACAGGTGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514534_1040514540 -3 Left 1040514534 8:48124175-48124197 CCGGTCTGTGGGTTTGGTCCCCA No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
1040514528_1040514540 19 Left 1040514528 8:48124153-48124175 CCAGAGTGTCCTGAGAGAGTTTC No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
1040514526_1040514540 25 Left 1040514526 8:48124147-48124169 CCAGACCCAGAGTGTCCTGAGAG No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
1040514527_1040514540 20 Left 1040514527 8:48124152-48124174 CCCAGAGTGTCCTGAGAGAGTTT No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
1040514530_1040514540 10 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514540 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514540 Original CRISPR CCAGAGCCACAGGTGCTGCT GGG Intergenic
No off target data available for this crispr