ID: 1040514541

View in Genome Browser
Species Human (GRCh38)
Location 8:48124201-48124223
Sequence GCACTTCCCAGCAGCACCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514541_1040514542 -9 Left 1040514541 8:48124201-48124223 CCACAGGTGCTGCTGGGAAGTGC No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514541_1040514547 14 Left 1040514541 8:48124201-48124223 CCACAGGTGCTGCTGGGAAGTGC No data
Right 1040514547 8:48124238-48124260 CAGTCCCATTTTAGCCACAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514541 Original CRISPR GCACTTCCCAGCAGCACCTG TGG (reversed) Intergenic
No off target data available for this crispr