ID: 1040514542

View in Genome Browser
Species Human (GRCh38)
Location 8:48124215-48124237
Sequence GGGAAGTGCCTGCAGACCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040514530_1040514542 30 Left 1040514530 8:48124162-48124184 CCTGAGAGAGTTTCCGGTCTGTG No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514536_1040514542 -1 Left 1040514536 8:48124193-48124215 CCCCAGAGCCACAGGTGCTGCTG No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514539_1040514542 -3 Left 1040514539 8:48124195-48124217 CCAGAGCCACAGGTGCTGCTGGG No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514537_1040514542 -2 Left 1040514537 8:48124194-48124216 CCCAGAGCCACAGGTGCTGCTGG No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514541_1040514542 -9 Left 1040514541 8:48124201-48124223 CCACAGGTGCTGCTGGGAAGTGC No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data
1040514534_1040514542 17 Left 1040514534 8:48124175-48124197 CCGGTCTGTGGGTTTGGTCCCCA No data
Right 1040514542 8:48124215-48124237 GGGAAGTGCCTGCAGACCCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040514542 Original CRISPR GGGAAGTGCCTGCAGACCCC TGG Intergenic
No off target data available for this crispr