ID: 1040516918

View in Genome Browser
Species Human (GRCh38)
Location 8:48143214-48143236
Sequence AAAGCCCTTCTTAGGCCCGG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040516914_1040516918 -4 Left 1040516914 8:48143195-48143217 CCTGGGCCTTCTCGCGAGGAAAG No data
Right 1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG No data
1040516915_1040516918 -10 Left 1040516915 8:48143201-48143223 CCTTCTCGCGAGGAAAGCCCTTC No data
Right 1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG No data
1040516910_1040516918 27 Left 1040516910 8:48143164-48143186 CCACATCGGGGATAAAAGGGGGA No data
Right 1040516918 8:48143214-48143236 AAAGCCCTTCTTAGGCCCGGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040516918 Original CRISPR AAAGCCCTTCTTAGGCCCGG CGG Intergenic
No off target data available for this crispr