ID: 1040518394

View in Genome Browser
Species Human (GRCh38)
Location 8:48153437-48153459
Sequence CTGTGCTCATTGCTGTTTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040518394_1040518401 22 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518401 8:48153482-48153504 TCTCTCCAACCAAGGTACCAGGG No data
1040518394_1040518404 27 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518404 8:48153487-48153509 CCAACCAAGGTACCAGGGAAGGG No data
1040518394_1040518400 21 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518400 8:48153481-48153503 CTCTCTCCAACCAAGGTACCAGG No data
1040518394_1040518398 14 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG No data
1040518394_1040518405 28 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518405 8:48153488-48153510 CAACCAAGGTACCAGGGAAGGGG No data
1040518394_1040518402 26 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518402 8:48153486-48153508 TCCAACCAAGGTACCAGGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040518394 Original CRISPR CTGTGCTCATTGCTGTTTCC AGG (reversed) Intergenic
No off target data available for this crispr