ID: 1040518398

View in Genome Browser
Species Human (GRCh38)
Location 8:48153474-48153496
Sequence AAGCCTGCTCTCTCCAACCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040518394_1040518398 14 Left 1040518394 8:48153437-48153459 CCTGGAAACAGCAATGAGCACAG No data
Right 1040518398 8:48153474-48153496 AAGCCTGCTCTCTCCAACCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040518398 Original CRISPR AAGCCTGCTCTCTCCAACCA AGG Intergenic
No off target data available for this crispr