ID: 1040521549

View in Genome Browser
Species Human (GRCh38)
Location 8:48180593-48180615
Sequence CTGCAGGCTCAGGTAGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040521549_1040521556 13 Left 1040521549 8:48180593-48180615 CCTTCCTCTACCTGAGCCTGCAG No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521549_1040521557 22 Left 1040521549 8:48180593-48180615 CCTTCCTCTACCTGAGCCTGCAG No data
Right 1040521557 8:48180638-48180660 ATCACCTAGATGGGCTCTTCTGG No data
1040521549_1040521555 12 Left 1040521549 8:48180593-48180615 CCTTCCTCTACCTGAGCCTGCAG No data
Right 1040521555 8:48180628-48180650 CTCACATCACATCACCTAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040521549 Original CRISPR CTGCAGGCTCAGGTAGAGGA AGG (reversed) Intergenic
No off target data available for this crispr