ID: 1040521556

View in Genome Browser
Species Human (GRCh38)
Location 8:48180629-48180651
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040521549_1040521556 13 Left 1040521549 8:48180593-48180615 CCTTCCTCTACCTGAGCCTGCAG No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521550_1040521556 9 Left 1040521550 8:48180597-48180619 CCTCTACCTGAGCCTGCAGTGAC No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521552_1040521556 -3 Left 1040521552 8:48180609-48180631 CCTGCAGTGACAGTTCCTCCTCA No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521547_1040521556 15 Left 1040521547 8:48180591-48180613 CCCCTTCCTCTACCTGAGCCTGC No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521548_1040521556 14 Left 1040521548 8:48180592-48180614 CCCTTCCTCTACCTGAGCCTGCA No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data
1040521551_1040521556 3 Left 1040521551 8:48180603-48180625 CCTGAGCCTGCAGTGACAGTTCC No data
Right 1040521556 8:48180629-48180651 TCACATCACATCACCTAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040521556 Original CRISPR TCACATCACATCACCTAGAT GGG Intergenic
No off target data available for this crispr