ID: 1040527301

View in Genome Browser
Species Human (GRCh38)
Location 8:48236313-48236335
Sequence GGAAGCAGTTAGAGTGGTCT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040527301_1040527306 -10 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527306 8:48236326-48236348 AACTGCTTCCTGCGGAATTGGGG 0: 3
1: 92
2: 77
3: 44
4: 275
1040527301_1040527309 0 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527309 8:48236336-48236358 TGCGGAATTGGGGCATAGTAGGG 0: 2
1: 51
2: 59
3: 45
4: 85
1040527301_1040527308 -1 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527308 8:48236335-48236357 CTGCGGAATTGGGGCATAGTAGG 0: 2
1: 52
2: 63
3: 50
4: 88
1040527301_1040527312 28 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527312 8:48236364-48236386 GCAGTTGAGATTTCCTCAGGAGG 0: 45
1: 60
2: 66
3: 24
4: 113
1040527301_1040527310 1 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527310 8:48236337-48236359 GCGGAATTGGGGCATAGTAGGGG 0: 2
1: 50
2: 62
3: 45
4: 87
1040527301_1040527313 29 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527313 8:48236365-48236387 CAGTTGAGATTTCCTCAGGAGGG 0: 43
1: 58
2: 62
3: 30
4: 145
1040527301_1040527314 30 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527314 8:48236366-48236388 AGTTGAGATTTCCTCAGGAGGGG 0: 43
1: 57
2: 54
3: 32
4: 151
1040527301_1040527311 25 Left 1040527301 8:48236313-48236335 CCAAGACCACTCTAACTGCTTCC No data
Right 1040527311 8:48236361-48236383 TGTGCAGTTGAGATTTCCTCAGG 0: 56
1: 68
2: 39
3: 33
4: 165

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040527301 Original CRISPR GGAAGCAGTTAGAGTGGTCT TGG (reversed) Intergenic
No off target data available for this crispr