ID: 1040528877

View in Genome Browser
Species Human (GRCh38)
Location 8:48249204-48249226
Sequence CCTACAATTTAAAACTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040528877_1040528882 27 Left 1040528877 8:48249204-48249226 CCCACCAAGTTTTAAATTGTAGG No data
Right 1040528882 8:48249254-48249276 GTAAGAGCATCCCAGTCAGTAGG 0: 22
1: 28
2: 35
3: 45
4: 323

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040528877 Original CRISPR CCTACAATTTAAAACTTGGT GGG (reversed) Intergenic
No off target data available for this crispr