ID: 1040530067

View in Genome Browser
Species Human (GRCh38)
Location 8:48259989-48260011
Sequence ACCTCAGGAGAGGATCTTGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040530063_1040530067 -5 Left 1040530063 8:48259971-48259993 CCTGAAGAAGGAGAGGGGACCTC No data
Right 1040530067 8:48259989-48260011 ACCTCAGGAGAGGATCTTGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040530067 Original CRISPR ACCTCAGGAGAGGATCTTGG AGG Intergenic
No off target data available for this crispr