ID: 1040535701

View in Genome Browser
Species Human (GRCh38)
Location 8:48307719-48307741
Sequence CCAAAGGCAAAATGAGCAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040535701_1040535706 9 Left 1040535701 8:48307719-48307741 CCTCTTGCTCATTTTGCCTTTGG No data
Right 1040535706 8:48307751-48307773 CAAAACATTCTTTAAAATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040535701 Original CRISPR CCAAAGGCAAAATGAGCAAG AGG (reversed) Intergenic
No off target data available for this crispr