ID: 1040537750

View in Genome Browser
Species Human (GRCh38)
Location 8:48324333-48324355
Sequence GGCTTACTCCCTGAGCCTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040537747_1040537750 13 Left 1040537747 8:48324297-48324319 CCAATCGGTTGTGTCTGTGAAGC No data
Right 1040537750 8:48324333-48324355 GGCTTACTCCCTGAGCCTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040537750 Original CRISPR GGCTTACTCCCTGAGCCTTC AGG Intergenic
No off target data available for this crispr