ID: 1040540120

View in Genome Browser
Species Human (GRCh38)
Location 8:48346346-48346368
Sequence CAAAATGCTGATGGTGATAG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040540114_1040540120 4 Left 1040540114 8:48346319-48346341 CCTACAGACCTGTTGAATGGCTT No data
Right 1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG No data
1040540115_1040540120 -4 Left 1040540115 8:48346327-48346349 CCTGTTGAATGGCTTTGACCAAA 0: 24
1: 54
2: 41
3: 65
4: 240
Right 1040540120 8:48346346-48346368 CAAAATGCTGATGGTGATAGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040540120 Original CRISPR CAAAATGCTGATGGTGATAG GGG Intergenic
No off target data available for this crispr