ID: 1040541619

View in Genome Browser
Species Human (GRCh38)
Location 8:48362158-48362180
Sequence CAGGGAAACCACTCAGAGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040541610_1040541619 8 Left 1040541610 8:48362127-48362149 CCTAACAGGGCCTAAGGTCTAAG No data
Right 1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG No data
1040541612_1040541619 -2 Left 1040541612 8:48362137-48362159 CCTAAGGTCTAAGGCTGAAAACA No data
Right 1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG No data
1040541609_1040541619 9 Left 1040541609 8:48362126-48362148 CCCTAACAGGGCCTAAGGTCTAA No data
Right 1040541619 8:48362158-48362180 CAGGGAAACCACTCAGAGGGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040541619 Original CRISPR CAGGGAAACCACTCAGAGGG GGG Intergenic
No off target data available for this crispr