ID: 1040542180

View in Genome Browser
Species Human (GRCh38)
Location 8:48370205-48370227
Sequence TGTACACTGTGGCCTGCTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040542177_1040542180 -5 Left 1040542177 8:48370187-48370209 CCCTGCTTAAGATTGGTATGTAC No data
Right 1040542180 8:48370205-48370227 TGTACACTGTGGCCTGCTATTGG No data
1040542178_1040542180 -6 Left 1040542178 8:48370188-48370210 CCTGCTTAAGATTGGTATGTACA No data
Right 1040542180 8:48370205-48370227 TGTACACTGTGGCCTGCTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040542180 Original CRISPR TGTACACTGTGGCCTGCTAT TGG Intergenic
No off target data available for this crispr