ID: 1040543306

View in Genome Browser
Species Human (GRCh38)
Location 8:48378547-48378569
Sequence CACCCCCAACGCAGTGCCGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040543306_1040543308 -9 Left 1040543306 8:48378547-48378569 CCACCGGCACTGCGTTGGGGGTG No data
Right 1040543308 8:48378561-48378583 TTGGGGGTGAGCTTCTTAACAGG No data
1040543306_1040543311 23 Left 1040543306 8:48378547-48378569 CCACCGGCACTGCGTTGGGGGTG No data
Right 1040543311 8:48378593-48378615 CATGAATGCTCTCCACCTGCGGG No data
1040543306_1040543310 22 Left 1040543306 8:48378547-48378569 CCACCGGCACTGCGTTGGGGGTG No data
Right 1040543310 8:48378592-48378614 ACATGAATGCTCTCCACCTGCGG No data
1040543306_1040543309 -6 Left 1040543306 8:48378547-48378569 CCACCGGCACTGCGTTGGGGGTG No data
Right 1040543309 8:48378564-48378586 GGGGTGAGCTTCTTAACAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040543306 Original CRISPR CACCCCCAACGCAGTGCCGG TGG (reversed) Intergenic
No off target data available for this crispr