ID: 1040543425

View in Genome Browser
Species Human (GRCh38)
Location 8:48379572-48379594
Sequence AGGCCAGACAGAGCACCTAC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040543425_1040543430 3 Left 1040543425 8:48379572-48379594 CCGGTAGGTGCTCTGTCTGGCCT No data
Right 1040543430 8:48379598-48379620 AGCAGGACTGGCCCTCCCCAGGG No data
1040543425_1040543429 2 Left 1040543425 8:48379572-48379594 CCGGTAGGTGCTCTGTCTGGCCT No data
Right 1040543429 8:48379597-48379619 TAGCAGGACTGGCCCTCCCCAGG No data
1040543425_1040543432 11 Left 1040543425 8:48379572-48379594 CCGGTAGGTGCTCTGTCTGGCCT No data
Right 1040543432 8:48379606-48379628 TGGCCCTCCCCAGGGAGTGAGGG No data
1040543425_1040543427 -9 Left 1040543425 8:48379572-48379594 CCGGTAGGTGCTCTGTCTGGCCT No data
Right 1040543427 8:48379586-48379608 GTCTGGCCTCTTAGCAGGACTGG No data
1040543425_1040543431 10 Left 1040543425 8:48379572-48379594 CCGGTAGGTGCTCTGTCTGGCCT No data
Right 1040543431 8:48379605-48379627 CTGGCCCTCCCCAGGGAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040543425 Original CRISPR AGGCCAGACAGAGCACCTAC CGG (reversed) Intergenic
No off target data available for this crispr