ID: 1040545504

View in Genome Browser
Species Human (GRCh38)
Location 8:48395675-48395697
Sequence CTACTCAGGAGGTCTGAGGC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040545498_1040545504 -8 Left 1040545498 8:48395660-48395682 CCCCTGTAGTTCTAGCTACTCAG No data
Right 1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG No data
1040545499_1040545504 -9 Left 1040545499 8:48395661-48395683 CCCTGTAGTTCTAGCTACTCAGG 0: 6
1: 104
2: 1008
3: 2904
4: 4061
Right 1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG No data
1040545501_1040545504 -10 Left 1040545501 8:48395662-48395684 CCTGTAGTTCTAGCTACTCAGGA 0: 177
1: 5015
2: 58715
3: 180905
4: 229971
Right 1040545504 8:48395675-48395697 CTACTCAGGAGGTCTGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040545504 Original CRISPR CTACTCAGGAGGTCTGAGGC AGG Intergenic
No off target data available for this crispr