ID: 1040547322

View in Genome Browser
Species Human (GRCh38)
Location 8:48408880-48408902
Sequence GAAGATGAGCAGATGCTGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040547319_1040547322 0 Left 1040547319 8:48408857-48408879 CCTAAACAGGGTCCATTTCGGAA No data
Right 1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG No data
1040547315_1040547322 22 Left 1040547315 8:48408835-48408857 CCTAAGTGCTCAGCAAGACTAAC No data
Right 1040547322 8:48408880-48408902 GAAGATGAGCAGATGCTGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040547322 Original CRISPR GAAGATGAGCAGATGCTGCT GGG Intergenic
No off target data available for this crispr