ID: 1040547322 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 8:48408880-48408902 |
| Sequence | GAAGATGAGCAGATGCTGCT GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | No |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1040547319_1040547322 | 0 | Left | 1040547319 | 8:48408857-48408879 | CCTAAACAGGGTCCATTTCGGAA | No data | ||
| Right | 1040547322 | 8:48408880-48408902 | GAAGATGAGCAGATGCTGCTGGG | No data | ||||
| 1040547315_1040547322 | 22 | Left | 1040547315 | 8:48408835-48408857 | CCTAAGTGCTCAGCAAGACTAAC | No data | ||
| Right | 1040547322 | 8:48408880-48408902 | GAAGATGAGCAGATGCTGCTGGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1040547322 | Original CRISPR | GAAGATGAGCAGATGCTGCT GGG | Intergenic | ||
| No off target data available for this crispr | |||||