ID: 1040549687

View in Genome Browser
Species Human (GRCh38)
Location 8:48428545-48428567
Sequence GAGGGTGAACCAAGGAAGGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040549676_1040549687 7 Left 1040549676 8:48428515-48428537 CCTTGGGGGGCGGGAGCGGGGGA No data
Right 1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG No data
1040549664_1040549687 29 Left 1040549664 8:48428493-48428515 CCTCTTACTCAAGCTTTGTTTTC No data
Right 1040549687 8:48428545-48428567 GAGGGTGAACCAAGGAAGGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040549687 Original CRISPR GAGGGTGAACCAAGGAAGGA GGG Intergenic
No off target data available for this crispr