ID: 1040550954

View in Genome Browser
Species Human (GRCh38)
Location 8:48437221-48437243
Sequence GGGGGCCTTCTCCTGGGCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040550942_1040550954 24 Left 1040550942 8:48437174-48437196 CCTTGTACGTGTGTCTAAAAACG No data
Right 1040550954 8:48437221-48437243 GGGGGCCTTCTCCTGGGCTTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040550954 Original CRISPR GGGGGCCTTCTCCTGGGCTT GGG Intergenic
No off target data available for this crispr