ID: 1040551070

View in Genome Browser
Species Human (GRCh38)
Location 8:48437993-48438015
Sequence CGGAACTGCAGGGGAACAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040551070_1040551078 5 Left 1040551070 8:48437993-48438015 CCTTCTGTTCCCCTGCAGTTCCG No data
Right 1040551078 8:48438021-48438043 AGAGCCCATGTTCAACTGCGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040551070 Original CRISPR CGGAACTGCAGGGGAACAGA AGG (reversed) Intergenic
No off target data available for this crispr