ID: 1040551489

View in Genome Browser
Species Human (GRCh38)
Location 8:48440892-48440914
Sequence CTGTATGTGCAGAATGTGGA CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040551489_1040551493 -4 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551493 8:48440911-48440933 ACAGAAAAGGAGATTCAGCTGGG No data
1040551489_1040551494 2 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551494 8:48440917-48440939 AAGGAGATTCAGCTGGGCTGTGG No data
1040551489_1040551496 14 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551496 8:48440929-48440951 CTGGGCTGTGGAGTTACTGAGGG No data
1040551489_1040551492 -5 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551492 8:48440910-48440932 TACAGAAAAGGAGATTCAGCTGG No data
1040551489_1040551495 13 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551495 8:48440928-48440950 GCTGGGCTGTGGAGTTACTGAGG No data
1040551489_1040551497 15 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551497 8:48440930-48440952 TGGGCTGTGGAGTTACTGAGGGG No data
1040551489_1040551499 24 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551499 8:48440939-48440961 GAGTTACTGAGGGGCAGAGGCGG No data
1040551489_1040551498 21 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551498 8:48440936-48440958 GTGGAGTTACTGAGGGGCAGAGG No data
1040551489_1040551500 25 Left 1040551489 8:48440892-48440914 CCGTCCACATTCTGCACATACAG No data
Right 1040551500 8:48440940-48440962 AGTTACTGAGGGGCAGAGGCGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040551489 Original CRISPR CTGTATGTGCAGAATGTGGA CGG (reversed) Intergenic
No off target data available for this crispr