ID: 1040561750

View in Genome Browser
Species Human (GRCh38)
Location 8:48528704-48528726
Sequence CTGTATAAGCAGTTAAATTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040561749_1040561750 -2 Left 1040561749 8:48528683-48528705 CCTACTAAATTCTTACTCGAGCT No data
Right 1040561750 8:48528704-48528726 CTGTATAAGCAGTTAAATTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040561750 Original CRISPR CTGTATAAGCAGTTAAATTC TGG Intergenic
No off target data available for this crispr