ID: 1040563985

View in Genome Browser
Species Human (GRCh38)
Location 8:48549627-48549649
Sequence ACTCCAGGCTTTTAACACAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040563985_1040563995 28 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563995 8:48549678-48549700 ATGGAGGATTTTAGGGTCCCAGG No data
1040563985_1040563989 -6 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563989 8:48549644-48549666 TGGAGTCTTAGGCTTTTCCAGGG No data
1040563985_1040563990 9 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563990 8:48549659-48549681 TTCCAGGGTGATCAGAGACATGG No data
1040563985_1040563993 20 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563993 8:48549670-48549692 TCAGAGACATGGAGGATTTTAGG No data
1040563985_1040563994 21 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563994 8:48549671-48549693 CAGAGACATGGAGGATTTTAGGG No data
1040563985_1040563992 12 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG No data
1040563985_1040563988 -7 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563988 8:48549643-48549665 CTGGAGTCTTAGGCTTTTCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040563985 Original CRISPR ACTCCAGGCTTTTAACACAG TGG (reversed) Intergenic
No off target data available for this crispr