ID: 1040563987

View in Genome Browser
Species Human (GRCh38)
Location 8:48549642-48549664
Sequence CTGGAAAAGCCTAAGACTCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040563987_1040563997 27 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563997 8:48549692-48549714 GGTCCCAGGCTAGGTAGACATGG No data
1040563987_1040563993 5 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563993 8:48549670-48549692 TCAGAGACATGGAGGATTTTAGG No data
1040563987_1040563990 -6 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563990 8:48549659-48549681 TTCCAGGGTGATCAGAGACATGG No data
1040563987_1040563995 13 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563995 8:48549678-48549700 ATGGAGGATTTTAGGGTCCCAGG No data
1040563987_1040563996 18 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563996 8:48549683-48549705 GGATTTTAGGGTCCCAGGCTAGG No data
1040563987_1040563992 -3 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG No data
1040563987_1040563994 6 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563994 8:48549671-48549693 CAGAGACATGGAGGATTTTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040563987 Original CRISPR CTGGAAAAGCCTAAGACTCC AGG (reversed) Intergenic
No off target data available for this crispr