ID: 1040563992

View in Genome Browser
Species Human (GRCh38)
Location 8:48549662-48549684
Sequence CAGGGTGATCAGAGACATGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040563985_1040563992 12 Left 1040563985 8:48549627-48549649 CCACTGTGTTAAAAGCCTGGAGT No data
Right 1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG No data
1040563987_1040563992 -3 Left 1040563987 8:48549642-48549664 CCTGGAGTCTTAGGCTTTTCCAG No data
Right 1040563992 8:48549662-48549684 CAGGGTGATCAGAGACATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040563992 Original CRISPR CAGGGTGATCAGAGACATGG AGG Intergenic
No off target data available for this crispr