ID: 1040567340

View in Genome Browser
Species Human (GRCh38)
Location 8:48579551-48579573
Sequence TAGGGCCAACTTTAGATTTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567340_1040567344 -5 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567344 8:48579569-48579591 CCCTAACAAATACTCCATTGGGG No data
1040567340_1040567341 -7 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567341 8:48579567-48579589 GGCCCTAACAAATACTCCATTGG No data
1040567340_1040567350 20 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567350 8:48579594-48579616 GAATTTGGGTGAAGTCACCATGG No data
1040567340_1040567351 24 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data
1040567340_1040567346 -4 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567346 8:48579570-48579592 CCTAACAAATACTCCATTGGGGG No data
1040567340_1040567348 6 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567348 8:48579580-48579602 ACTCCATTGGGGGAGAATTTGGG No data
1040567340_1040567342 -6 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567342 8:48579568-48579590 GCCCTAACAAATACTCCATTGGG No data
1040567340_1040567347 5 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567347 8:48579579-48579601 TACTCCATTGGGGGAGAATTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567340 Original CRISPR TAGGGCCAACTTTAGATTTT AGG (reversed) Intergenic