ID: 1040567341

View in Genome Browser
Species Human (GRCh38)
Location 8:48579567-48579589
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567339_1040567341 -6 Left 1040567339 8:48579550-48579572 CCCTAAAATCTAAAGTTGGCCCT No data
Right 1040567341 8:48579567-48579589 GGCCCTAACAAATACTCCATTGG No data
1040567340_1040567341 -7 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567341 8:48579567-48579589 GGCCCTAACAAATACTCCATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567341 Original CRISPR GGCCCTAACAAATACTCCAT TGG Intergenic
No off target data available for this crispr