ID: 1040567350

View in Genome Browser
Species Human (GRCh38)
Location 8:48579594-48579616
Sequence GAATTTGGGTGAAGTCACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567339_1040567350 21 Left 1040567339 8:48579550-48579572 CCCTAAAATCTAAAGTTGGCCCT No data
Right 1040567350 8:48579594-48579616 GAATTTGGGTGAAGTCACCATGG No data
1040567340_1040567350 20 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567350 8:48579594-48579616 GAATTTGGGTGAAGTCACCATGG No data
1040567345_1040567350 1 Left 1040567345 8:48579570-48579592 CCTAACAAATACTCCATTGGGGG No data
Right 1040567350 8:48579594-48579616 GAATTTGGGTGAAGTCACCATGG No data
1040567343_1040567350 2 Left 1040567343 8:48579569-48579591 CCCTAACAAATACTCCATTGGGG No data
Right 1040567350 8:48579594-48579616 GAATTTGGGTGAAGTCACCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567350 Original CRISPR GAATTTGGGTGAAGTCACCA TGG Intergenic
No off target data available for this crispr