ID: 1040567351

View in Genome Browser
Species Human (GRCh38)
Location 8:48579598-48579620
Sequence TTGGGTGAAGTCACCATGGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567345_1040567351 5 Left 1040567345 8:48579570-48579592 CCTAACAAATACTCCATTGGGGG No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data
1040567349_1040567351 -8 Left 1040567349 8:48579583-48579605 CCATTGGGGGAGAATTTGGGTGA No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data
1040567340_1040567351 24 Left 1040567340 8:48579551-48579573 CCTAAAATCTAAAGTTGGCCCTA No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data
1040567339_1040567351 25 Left 1040567339 8:48579550-48579572 CCCTAAAATCTAAAGTTGGCCCT No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data
1040567343_1040567351 6 Left 1040567343 8:48579569-48579591 CCCTAACAAATACTCCATTGGGG No data
Right 1040567351 8:48579598-48579620 TTGGGTGAAGTCACCATGGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567351 Original CRISPR TTGGGTGAAGTCACCATGGA TGG Intergenic
No off target data available for this crispr