ID: 1040567874

View in Genome Browser
Species Human (GRCh38)
Location 8:48582862-48582884
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567874_1040567886 17 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567886 8:48582902-48582924 AGTCAGGGAGGAGTCTGGTGAGG No data
1040567874_1040567879 -8 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data
1040567874_1040567878 -9 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567878 8:48582876-48582898 TTTGGGGGCCCTTGTGGGTCTGG No data
1040567874_1040567885 12 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567885 8:48582897-48582919 GGGAGAGTCAGGGAGGAGTCTGG No data
1040567874_1040567882 1 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567882 8:48582886-48582908 CTTGTGGGTCTGGGAGAGTCAGG No data
1040567874_1040567888 23 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567888 8:48582908-48582930 GGAGGAGTCTGGTGAGGTCTGGG No data
1040567874_1040567887 22 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567887 8:48582907-48582929 GGGAGGAGTCTGGTGAGGTCTGG No data
1040567874_1040567884 5 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567884 8:48582890-48582912 TGGGTCTGGGAGAGTCAGGGAGG No data
1040567874_1040567883 2 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567883 8:48582887-48582909 TTGTGGGTCTGGGAGAGTCAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567874 Original CRISPR GCCCCCAAAACCACCGTCCT GGG (reversed) Intergenic
No off target data available for this crispr