ID: 1040567879

View in Genome Browser
Species Human (GRCh38)
Location 8:48582877-48582899
Sequence TTGGGGGCCCTTGTGGGTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1040567872_1040567879 -7 Left 1040567872 8:48582861-48582883 CCCCAGGACGGTGGTTTTGGGGG No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data
1040567875_1040567879 -9 Left 1040567875 8:48582863-48582885 CCAGGACGGTGGTTTTGGGGGCC No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data
1040567874_1040567879 -8 Left 1040567874 8:48582862-48582884 CCCAGGACGGTGGTTTTGGGGGC No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data
1040567857_1040567879 29 Left 1040567857 8:48582825-48582847 CCAGGGATGGGGTGAGCCAGGGG No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data
1040567865_1040567879 13 Left 1040567865 8:48582841-48582863 CCAGGGGGAAGGGTGGGGATCCC No data
Right 1040567879 8:48582877-48582899 TTGGGGGCCCTTGTGGGTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1040567879 Original CRISPR TTGGGGGCCCTTGTGGGTCT GGG Intergenic
No off target data available for this crispr